View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_141 (Length: 258)
Name: NF0214_high_141
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_141 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 5 - 229
Target Start/End: Original strand, 27230661 - 27230885
Alignment:
| Q |
5 |
tccattagcattataagctattaaagatggtggacaaacatttccaaaatccatattacaggtcacaactggacatggacctgaaccatccaacaatgtt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27230661 |
tccattagcattataagctattaaagatggtggacaaacatttccaaaatccatattacaggtcacaactggacatggacctgatccatccaacaatgtt |
27230760 |
T |
|
| Q |
105 |
ccaccaacaggtttgatattaacaaaaatattttgtccatgaatcaaacttatttcataggaaacaattgattcgttaacgttgaaattgagaagtgtta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27230761 |
ccaccaacaggtttgatattaacaaaaatattttgtccatgaatcaaacttatttcataggaaacaattgattcgttaacgttgaaattgagaagtgtta |
27230860 |
T |
|
| Q |
205 |
cgggataattaggtgttgtgtctgc |
229 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
27230861 |
cgggataattaggtgttgtgtctgc |
27230885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1764 times since January 2019
Visitors: 2393