View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_15 (Length: 515)
Name: NF0214_high_15
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 2e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 79 - 346
Target Start/End: Complemental strand, 21956067 - 21955800
Alignment:
Q |
79 |
gtttgggtgttatgggagaagggaggtttgtggtggtgttgggcatggtggaagatttgaagggagagataagggtcgtgttggcgggaaatgagagatg |
178 |
Q |
|
|
||||||| |||||| ||||| ||||||||||| |||| |||||| ||| |||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
T |
21956067 |
gtttgggggttatgagagaatggaggtttgtgatggttttgggcgtggaggaagatttgaagggagaaatgagggtcgtgttggcgggaaatgagagatg |
21955968 |
T |
 |
Q |
179 |
agaggagtttggggttgaggcggtggggccagggtttgattggtggttggactttgaaggaatctgggagggaaggtgtggtggttgtattggcagcgat |
278 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| | || | |||||||||||||||||||||||| ||||| |||| |
|
|
T |
21955967 |
agaggagtttggggttgaggcggtggggccagggtttgattggaggttggattttgtatgattgtgggagggaaggtgtggtggttgtgttggcgacgat |
21955868 |
T |
 |
Q |
279 |
ggcggcggagattgcggtggagaatcggtggtggtgggagggaatgagagaacgcattttcgttgttg |
346 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
T |
21955867 |
tgcggcggagattgcggtggagaatcggtggtggtgggagggaatgagagaacgcattgttgttgttg |
21955800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 379 - 407
Target Start/End: Complemental strand, 21955657 - 21955629
Alignment:
Q |
379 |
gccacttccttcacctaaacaccaaatca |
407 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
21955657 |
gccacttccttcacctaaacaccaaatca |
21955629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 470 - 510
Target Start/End: Original strand, 17810526 - 17810566
Alignment:
Q |
470 |
aaaattatccagcaaaatgaaagtacaagagaataatctac |
510 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17810526 |
aaaattatccagcaaaatgaaagtacaagagaataatctac |
17810566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1629 times since January 2019
Visitors: 2392