View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_high_150 (Length: 255)

Name: NF0214_high_150
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_high_150
NF0214_high_150
[»] chr3 (1 HSPs)
chr3 (30-255)||(55414405-55414630)


Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 30 - 255
Target Start/End: Original strand, 55414405 - 55414630
Alignment:
30 gttatcaccggaagatggagtccttccagtgcagatcgtgcggcagggaggctcctgggctacggtacggtgacaaacataataaacggagggcttgaat 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||    
55414405 gttatcaccggaagatggagtccttccagtgcagatcgtgcggcagggaggctcccgggatacggtacggtgaccaacataataaacggagggcttgaat 55414504  T
130 gcggaagaggacaggatggaagagtgcaggatcgaattggattttacaagagatattgtgacatacttggagttggatacggagacaatcttgattgttt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
55414505 gcggaagaggacaggatggaagagtgcaggatcgaattggattttacaagagatattgtgacatacttggagttggatatggagacaatcttgattgttt 55414604  T
230 ttctcaaaggcctttcggatcttcac 255  Q
    ||||||||||||||||||||||||||    
55414605 ttctcaaaggcctttcggatcttcac 55414630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University