View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_150 (Length: 255)
Name: NF0214_high_150
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_150 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 30 - 255
Target Start/End: Original strand, 55414405 - 55414630
Alignment:
| Q |
30 |
gttatcaccggaagatggagtccttccagtgcagatcgtgcggcagggaggctcctgggctacggtacggtgacaaacataataaacggagggcttgaat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55414405 |
gttatcaccggaagatggagtccttccagtgcagatcgtgcggcagggaggctcccgggatacggtacggtgaccaacataataaacggagggcttgaat |
55414504 |
T |
 |
| Q |
130 |
gcggaagaggacaggatggaagagtgcaggatcgaattggattttacaagagatattgtgacatacttggagttggatacggagacaatcttgattgttt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
55414505 |
gcggaagaggacaggatggaagagtgcaggatcgaattggattttacaagagatattgtgacatacttggagttggatatggagacaatcttgattgttt |
55414604 |
T |
 |
| Q |
230 |
ttctcaaaggcctttcggatcttcac |
255 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
55414605 |
ttctcaaaggcctttcggatcttcac |
55414630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University