View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_high_152 (Length: 253)

Name: NF0214_high_152
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_high_152
NF0214_high_152
[»] chr1 (1 HSPs)
chr1 (1-200)||(25575157-25575356)


Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 25575356 - 25575157
Alignment:
1 tagctaaaagagaaccactagagtaatcttctttgtcatcctttctgtcatagccacaggaaggtttgtagcgatcaaattccaaagtattcccattccc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
25575356 tagctaaaagagaaccactagagtaatcttctttgtcatcctttctgtcatagccacaggaaggtctgtagcgatcaaattccaaagtattcccattccc 25575257  T
101 gcagtcagttgccttgccatgagttggctcggcccctctaccaatgcgaccctggttaggaacaacatggccaccttcatctggaaagtctcttcgacga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25575256 gcagtcagttgccttgccatgagttggctcggcccctctaccaatgcgaccctggttaggaacaacatggccaccttcatctggaaagtctcttcgacga 25575157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University