View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_152 (Length: 253)
Name: NF0214_high_152
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_152 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 25575356 - 25575157
Alignment:
| Q |
1 |
tagctaaaagagaaccactagagtaatcttctttgtcatcctttctgtcatagccacaggaaggtttgtagcgatcaaattccaaagtattcccattccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25575356 |
tagctaaaagagaaccactagagtaatcttctttgtcatcctttctgtcatagccacaggaaggtctgtagcgatcaaattccaaagtattcccattccc |
25575257 |
T |
|
| Q |
101 |
gcagtcagttgccttgccatgagttggctcggcccctctaccaatgcgaccctggttaggaacaacatggccaccttcatctggaaagtctcttcgacga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25575256 |
gcagtcagttgccttgccatgagttggctcggcccctctaccaatgcgaccctggttaggaacaacatggccaccttcatctggaaagtctcttcgacga |
25575157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1362 times since January 2019
Visitors: 2391