View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_156 (Length: 252)
Name: NF0214_high_156
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_156 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 32 - 237
Target Start/End: Original strand, 43663887 - 43664092
Alignment:
| Q |
32 |
aattaattagtgggtttcatcctcaacttccattcattatatttatgctccattgactcgataaagcatgccactttctaaattannnnnnnnnnnnnnn |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43663887 |
aattaattagtgggtttcatcctcaacttccattcattatatttatgctccattgactcgataaagcatgccactttctaaattattttcttttgttttt |
43663986 |
T |
 |
| Q |
132 |
ncttggtctccagttagcaatcaagggtgaaattaatttttgatattattcacacggcactagagctgcaataccaccaatcatatatttgttgtgctat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43663987 |
tcttggtctccagttagcaatcaagggtgaaattaatttttgatattattcacacggcactagagctgcaataccaccaatcatatatttcttgtgctat |
43664086 |
T |
 |
| Q |
232 |
tttata |
237 |
Q |
| |
|
|||||| |
|
|
| T |
43664087 |
tttata |
43664092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University