View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_158 (Length: 251)
Name: NF0214_high_158
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_158 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 28495851 - 28495634
Alignment:
Q |
1 |
ttttgtgatgcattggcagaagagagtgcaagagtaacttcagttacaacaacaaatctaaattttaagaatgaagaaggtagtgctatgatgaatccac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28495851 |
ttttgtgatgcattggcagaagagagtgcaagagtaacttcagttacaacaacaaatctaaattttaagaatgaagaaggtagtgctatgatgaatccac |
28495752 |
T |
 |
Q |
101 |
attcacattcagaacatggtttatcacatggaatacttcaaaatataggtggaattccacatccacaatttggctcacatggatttcatcatgtagattt |
200 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28495751 |
attcacattcacaacatggtttatcacatggaatacttcaaaatataggtggaattccacatccacaatttggctcacatggatttcatcatgtagattt |
28495652 |
T |
 |
Q |
201 |
caatggaattggaaacaa |
218 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
28495651 |
caatggaattggaaacaa |
28495634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 5788029 - 5787996
Alignment:
Q |
1 |
ttttgtgatgcattggcagaagagagtgcaagag |
34 |
Q |
|
|
|||||||||||||| ||||||||||||||||||| |
|
|
T |
5788029 |
ttttgtgatgcattagcagaagagagtgcaagag |
5787996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University