View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_159 (Length: 250)
Name: NF0214_high_159
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_159 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 5522554 - 5522775
Alignment:
Q |
1 |
taaaaacatcctcaatggctccaactcgagataataacaaaaatgaagacttcattccttcatgaactgcttaatggaatttctattagctcaacttgtt |
100 |
Q |
|
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5522554 |
taaaaacatcctcaaaggctccaactcaagataataacaaaaatgaagacttcattccttcatgaactgcttaatggaatttctattagctcaacttgtt |
5522653 |
T |
 |
Q |
101 |
cggttgggaagtcgtcaaaaagatacttgccggattcttctggcgtatacagcaaatccattgcaaaatctaggcaaggtattgacacccctacattaac |
200 |
Q |
|
|
||||||||||||| ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5522654 |
cggttgggaagtcatcaaaaagatatttgccggattcttctagcgtatacagcaaatccattgcaaaatctaggcaaggtattgacacccctacattaac |
5522753 |
T |
 |
Q |
201 |
aaaactgtaattcatgaatact |
222 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
5522754 |
aaaactgtaattcatgaatact |
5522775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 40 - 143
Target Start/End: Complemental strand, 51754352 - 51754249
Alignment:
Q |
40 |
aaaatgaagacttcattccttcatgaactgcttaatggaatttctattagctcaacttgttcggttgggaagtcgtcaaaaagatacttgccggattctt |
139 |
Q |
|
|
|||||||| |||||||| |||||||| || ||||||||||| ||||||||||||| || | ||| |||||| || |||| ||||||||||| |||||| |
|
|
T |
51754352 |
aaaatgaatacttcatttcttcatgagctacttaatggaatctctattagctcaagttatccggctgggaaatcctcaaggagatacttgcctgattcta |
51754253 |
T |
 |
Q |
140 |
ctgg |
143 |
Q |
|
|
|||| |
|
|
T |
51754252 |
ctgg |
51754249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 96
Target Start/End: Complemental strand, 51768978 - 51768927
Alignment:
Q |
45 |
gaagacttcattccttcatgaactgcttaatggaatttctattagctcaact |
96 |
Q |
|
|
|||||| |||||||||||||| || ||||||||||||||||| | ||||||| |
|
|
T |
51768978 |
gaagacatcattccttcatgagctacttaatggaatttctatcacctcaact |
51768927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University