View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_163 (Length: 248)
Name: NF0214_high_163
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_163 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 56281283 - 56281488
Alignment:
Q |
15 |
aatcaagggcttggctccgcctttaaataannnnnnnnnnnnncatataccatacttgaattatccccttctttattttcttgctcaagattcaaagcgt |
114 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56281283 |
aatcaagggcttggctccgcctttaaataatttttctttttttcatataccatacttgaattatccccttctttattttcttgctcaagattcaaagcgt |
56281382 |
T |
 |
Q |
115 |
ttgataccatgagaaattgaaagagacaccaaagactttcagcttcattgtattgcaatgctaatattggcatttggctcaaatgattcatttcgttcta |
214 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56281383 |
ttgataccatgagaaattgaaagagacaccaaagactttcagcttcattgtattgcaatgctaatattggcatttggctcaaatgattcatttcgttcta |
56281482 |
T |
 |
Q |
215 |
tttatt |
220 |
Q |
|
|
|||||| |
|
|
T |
56281483 |
tttatt |
56281488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University