View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_167 (Length: 245)
Name: NF0214_high_167
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_167 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 216
Target Start/End: Original strand, 40763671 - 40763871
Alignment:
| Q |
16 |
gctgttgctcggattgggaaggctcttgcttatgctacacatacattttgcaacaagcatgggtttctttatgtgcgcacgccaattgtcacgacaagtg |
115 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40763671 |
gctgttgctcggattgggaatgctcttgcttatgctacacatacatttttcaacaagcatgggtttctttatgtgcgcacgccaattgtcacgacaagtg |
40763770 |
T |
|
| Q |
116 |
attgtgagggtgctggtgaaatgtttcaagtgacaactctgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40763771 |
attgtgagggtgctggtgaaatgtttcaagtgacaactctgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaatc |
40763870 |
T |
|
| Q |
216 |
t |
216 |
Q |
| |
|
| |
|
|
| T |
40763871 |
t |
40763871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 40763938 - 40763991
Alignment:
| Q |
163 |
gaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaatct |
216 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40763938 |
gaagcagaaaggttggagaaggaacagatacagaatcctcctcctactgaatct |
40763991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 213
Target Start/End: Original strand, 42911399 - 42911596
Alignment:
| Q |
16 |
gctgttgctcggattgggaaggctcttgcttatgctacacatacattttgcaacaagcatgggtttctttatgtgcgcacgccaattgtcacgacaagtg |
115 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
42911399 |
gctgttgctcggattcggaatgctcttgcttatgctacacatacatttttcaacaagcatgggtttctttatgtgcacacgccaattgtcacgactagtg |
42911498 |
T |
|
| Q |
116 |
attgtgagggtgctggtgaaatgtttcaagtgacaactctgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42911499 |
attgtgagggtgctggtgaaatgtttcaagtgacaactttgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctccaactgaa |
42911596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1739 times since January 2019
Visitors: 2393