View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_high_172 (Length: 225)

Name: NF0214_high_172
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_high_172
NF0214_high_172
[»] chr3 (1 HSPs)
chr3 (1-137)||(46837387-46837524)


Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 46837387 - 46837524
Alignment:
1 ttatcattatttgctttatcattgactctcaaactagagatttt-attcgattaataattagattgagaaagttaacttttatcaagactcttagttatc 99  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46837387 ttatcattatttgctttatcattgactctcaaactagagatttttattcgattaataattagattgagaaagttaacttttatcaagactcttagttatc 46837486  T
100 actccgctcttattgcaggtgattgatgagtatgatga 137  Q
    ||||| ||||||||||||||||||||||||||||||||    
46837487 actcccctcttattgcaggtgattgatgagtatgatga 46837524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University