View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_43 (Length: 413)
Name: NF0214_high_43
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_43 |
 | |
|
| [»] scaffold0016 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 51 - 172
Target Start/End: Complemental strand, 33715095 - 33714973
Alignment:
| Q |
51 |
ctatggctgcactgtaatggttcagataaaaagataaattaacatttccatctataaactcaacgatatgaaaggaaaac-tttttcatgtaacatagcc |
149 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| |||||||||| || |||||||||| |||||| || |||||| ||| | ||||| ||||||||||||| |
|
|
| T |
33715095 |
ctatggctgcactgcaatggttcagttaaaacaataaattaaccttgccatctataagctcaacaatttgaaagtaaacctttttttatgtaacatagcc |
33714996 |
T |
|
| Q |
150 |
atagctctatatactatctacaa |
172 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33714995 |
atagctctatatactatctacaa |
33714973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 34 - 87
Target Start/End: Original strand, 46968 - 47021
Alignment:
| Q |
34 |
cctaacatatgtttcttctatggctgcactgtaatggttcagataaaaagataa |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46968 |
cctaacatatgtttcttctatggctgcactgtaatggttcagataaaaagataa |
47021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 191 - 269
Target Start/End: Complemental strand, 43206878 - 43206799
Alignment:
| Q |
191 |
tattataaattgagagaaattaatgaat-ctcattgtttcattaattggaaaggttcaatacaacatctatatatacaaa |
269 |
Q |
| |
|
|||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||| |||||| ||||| |
|
|
| T |
43206878 |
tattatgaattgagagaaatgaatgaatactcattgtttcattaattggaaaggttcagtacaacatgtatatacacaaa |
43206799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2013 times since January 2019
Visitors: 2396