View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_5 (Length: 613)
Name: NF0214_high_5
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 226 - 462
Target Start/End: Complemental strand, 28814389 - 28814160
Alignment:
Q |
226 |
gctaggtgtcagcttgtaaaacagttcctgatcctactcagcaggctaccaaccctcttaaggacacagaatcatatgtgcctacattctcgttttctcc |
325 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
T |
28814389 |
gctaggtgtcagcttgtaaaacagttcctgatcctactcagcaggctaccaaccctcttaaggacacaggatcatatgtgcctacattctcgttctctcc |
28814290 |
T |
 |
Q |
326 |
taattacttttcttacaaatcatatgattcacttccactaatgtcttttgtgtgcttaacaaaacaaacactcacttttgcatataataaaataaatata |
425 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28814289 |
taattacttttcttaca-------tgattcacttccactaatgtcttttgtgtgcttaacaaaacaaacactcacttttgcatataataaaataaatata |
28814197 |
T |
 |
Q |
426 |
ccattttcatcatccacatgcaaatttatcacttttt |
462 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||| |
|
|
T |
28814196 |
ccattttcatcatccacatgcaaatttaccacttttt |
28814160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 104 - 180
Target Start/End: Complemental strand, 28814527 - 28814451
Alignment:
Q |
104 |
tcttggaaaatgtttcagatggtaaaaatgaaatcacttttgttttgttttggttgatatatacttttctcttcttg |
180 |
Q |
|
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28814527 |
tcttgaaaaatgtttgagatggtaaaaatgaaatcacttttgttttgttttggttgatatatacttttctcttcttg |
28814451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 968 times since January 2019
Visitors: 2388