View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_53 (Length: 389)
Name: NF0214_high_53
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 12 - 360
Target Start/End: Original strand, 24865210 - 24865558
Alignment:
| Q |
12 |
atgaatccataatgaattacacgtgaagaactatatccatccaaaatagggaatgatctcaaatcatagcgcaactgtaccatacagcacttgtgttctt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
24865210 |
atgaatccataatgaattacacgtgaagaactatatccacccaaaatagggaatgatctcaaatcatagcgcaactgtaccatacagcacttgtgttttt |
24865309 |
T |
 |
| Q |
112 |
ttgtttctttcagttagcccctttgtaggtaacgtttacgagacatttgcaaccagattcagtactatttgtcaagcacccacacacttggaaaacattc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24865310 |
ttgtttctttcagttagcccctttgtaggtaacgtttacgagacatttgcaaccagattcagtactatttgttaagcacccacacacttggaaaacattc |
24865409 |
T |
 |
| Q |
212 |
agaagttagctgtcctggggaagaactaagctacttaagtactccaacatgcatttaatataattcgatgcggcacttggtcaccccataatacccaact |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24865410 |
agaagttagctgtcctggggaagaactaagctacttaagtactccaacatgcattcaatataattcgatgcggcacttggtcaccccataatacccaact |
24865509 |
T |
 |
| Q |
312 |
tctatcaattccactcttccaaactcatctagattttcaacttcaatag |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24865510 |
tctatcaattccactcttccaaactcatctagattttcaacttcaatag |
24865558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University