View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_59 (Length: 365)
Name: NF0214_high_59
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 36 - 238
Target Start/End: Original strand, 1237435 - 1237637
Alignment:
| Q |
36 |
taaaaaccaaatacagaacaagcattcttaatcaatcagcaggagtacttaatatatctaactttgtac----ctaggatcaaatacaagagca---att |
128 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
1237435 |
taaaaaccaaatacagaagaagcattcttaatcaatcagcaggagtacttaatatatctaactttgtacctagctaggatcaaatacaagagcaattatt |
1237534 |
T |
|
| Q |
129 |
agcagcaacatgttcaaaacatcatgacatgccccaatgcttatcatattattattagctatcaattgtacagtttggtccttggaacgatacagttggt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1237535 |
agcagcaacatgttcaaaacatcatgacat-ccccaatgcttatca------tattagctatcaattgtacagtttggtccttggaacgatacagttggt |
1237627 |
T |
|
| Q |
229 |
cgatcttttt |
238 |
Q |
| |
|
|||||||||| |
|
|
| T |
1237628 |
cgatcttttt |
1237637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1114 times since January 2019
Visitors: 2389