View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_6 (Length: 583)
Name: NF0214_high_6
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_6 |
 |  |
|
[»] chr4 (245 HSPs) |
 |  |
|
[»] chr3 (235 HSPs) |
 |  |
|
[»] scaffold0196 (1 HSPs) |
 |  |  |
|
[»] scaffold0444 (2 HSPs) |
 |  |  |
|
[»] scaffold0007 (3 HSPs) |
 |  |  |
|
[»] scaffold0083 (2 HSPs) |
 |  |  |
|
[»] scaffold0060 (5 HSPs) |
 |  |  |
|
[»] scaffold0036 (2 HSPs) |
 |  |  |
|
[»] scaffold0001 (1 HSPs) |
 |  |  |
|
[»] scaffold0572 (1 HSPs) |
 |  |  |
|
[»] scaffold0498 (2 HSPs) |
 |  |  |
|
[»] scaffold0095 (1 HSPs) |
 |  |  |
|
[»] scaffold0041 (2 HSPs) |
 |  |  |
|
[»] scaffold0945 (2 HSPs) |
 |  |  |
|
[»] scaffold1532 (1 HSPs) |
 |  |  |
|
[»] scaffold0445 (2 HSPs) |
 |  |  |
|
[»] scaffold0340 (2 HSPs) |
 |  |  |
|
[»] scaffold0031 (3 HSPs) |
 |  |  |
|
[»] scaffold0008 (1 HSPs) |
 |  |  |
|
[»] scaffold0343 (2 HSPs) |
 |  |  |
|
[»] scaffold0320 (2 HSPs) |
 |  |  |
|
[»] scaffold0219 (1 HSPs) |
 |  |  |
|
[»] scaffold0022 (2 HSPs) |
 |  |  |
|
[»] scaffold0004 (4 HSPs) |
 |  |  |
|
[»] scaffold0057 (1 HSPs) |
 |  |  |
|
[»] scaffold0006 (2 HSPs) |
 |  |  |
|
[»] scaffold0132 (1 HSPs) |
 |  |  |
|
[»] scaffold0287 (1 HSPs) |
 |  |  |
|
[»] scaffold1063 (2 HSPs) |
 |  |  |
|
[»] scaffold0608 (1 HSPs) |
 |  |  |
|
[»] scaffold0140 (2 HSPs) |
 |  |  |
|
[»] scaffold0672 (2 HSPs) |
 |  |  |
|
[»] scaffold0474 (2 HSPs) |
 |  |  |
|
[»] scaffold0044 (1 HSPs) |
 |  |  |
|
[»] scaffold0214 (2 HSPs) |
 |  |  |
|
[»] scaffold0066 (1 HSPs) |
 |  |  |
|
[»] scaffold0015 (2 HSPs) |
 |  |  |
|
[»] scaffold0096 (2 HSPs) |
 |  |  |
|
[»] scaffold0249 (1 HSPs) |
 |  |  |
|
[»] scaffold0063 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 245)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 97 - 583
Target Start/End: Original strand, 4940194 - 4940666
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttgggatgtttgggcatata |
196 |
Q |
|
|
||||||||| |||||||||||| || |||||||||||| ||||||||||||||||| |||| || ||||||||||||||||||||||||||||| ||| |
|
|
T |
4940194 |
tgaacatgatgttttgcaaatacaccatgaagttttgcaattatgtgcaaaatgccctccaaatttaaaaatttatatttttgggatgtttgggca-ata |
4940292 |
T |
 |
Q |
197 |
cacaggtgaggaagttggaactgctgatttcaatttcaattctagtatttgtaatggcggcatgtttctttggtgaattgagctatggaaaaccccctcc |
296 |
Q |
|
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||||||| | | |
|
|
T |
4940293 |
tacaggtgaggaagttggaactgcttatttcaatt------ctagtatttgtaatggctgcatgtttctttggtgaattgagctatgtaaaacccc-tgc |
4940385 |
T |
 |
Q |
297 |
taaaggagtaattaagcgaatat-tgattaactgagtacatactaatattatatgacatatatttaattgattatgcaggatgcatgcagatgctttctc |
395 |
Q |
|
|
|||||||||||||||| |||||| || |||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| || |||||| |
|
|
T |
4940386 |
taaaggagtaattaagggaatatctggttaattgagtacatactaatattatatgacatatattcaattgattacgcaggatgcatgcaaatactttcta |
4940485 |
T |
 |
Q |
396 |
attgagagtggtttcgcgctgttcgttgcatttctaatcaatgttgcaatgatttatgtgactggtactgtttgcaaagctgatgatacttctggagaga |
495 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| ||||| |
|
|
T |
4940486 |
attgagagtggtttcg-------cgttgcatttctaatcaatgttgcaatgatttttgtgactggtactgtttacaaagctgatgatatttctgaagaga |
4940578 |
T |
 |
Q |
496 |
atactgatcgttgcaatgatattacccttgactttgcttctttcattctcctagtttctaatttagttcaatttgcaactattatggt |
583 |
Q |
|
|
|| |||||||||||||||||||||| ||| ||| |||||||||| |||||| ||| |||||||| |||| | | ||||||||||||| |
|
|
T |
4940579 |
atgctgatcgttgcaatgatattactcttaactctgcttctttccttctccaggttcctaatttacttcactctccaactattatggt |
4940666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 320 - 583
Target Start/End: Original strand, 38350966 - 38351229
Alignment:
Q |
320 |
tgattaactgagtacatactaatattatatgacatatatttaattgattatgcaggatgcatgcagatgctttctcattgagagtggtttcgcgctgttc |
419 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||||| || ||||| |
|
|
T |
38350966 |
tgattaattgagtacatgctaatattatatgacatatatttaatagattatgcgggatgcatgcatatactttctcattgagagtggtttcacgttgttc |
38351065 |
T |
 |
Q |
420 |
gttgcatttctaatcaatgttgcaatgatttatgtgactggtactgtttgcaaagctgatgatacttctggagagaatactgatcgttgcaatgatatta |
519 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
T |
38351066 |
gttgcatttctaatcaatgttgcaatgatttatgtgactggtactgcttgcaaagctgatgatatttctggagagaatgctgatcgttgcaatgatatta |
38351165 |
T |
 |
Q |
520 |
cccttgactttgcttctttcattctcctagtttctaatttagttcaatttgcaactattatggt |
583 |
Q |
|
|
||||| ||| |||||||||| |||||| ||| ||||||||||||| ||||||||||||||||| |
|
|
T |
38351166 |
cccttaactctgcttctttccttctccaggttcctaatttagttcactttgcaactattatggt |
38351229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 97 - 320
Target Start/End: Original strand, 21310950 - 21311166
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttgggatgtttgggcatata |
196 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
21310950 |
tgaacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttatatttttgggatgtttgggcatat- |
21311048 |
T |
 |
Q |
197 |
cacaggtgaggaagttggaactgctgatttcaatttcaattctagtatttgtaatggcggcatgtttctttggtgaattgagctatggaaaaccccctcc |
296 |
Q |
|
|
||||||||||||||||||||| |||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||| ||| ||||| | |
|
|
T |
21311049 |
-acaggtgaggaagttggaactcctgatttcaatt----ctagagtatttgtaatggctgcatgtttctttggtgaattgagctatgtgaaa-cccctgc |
21311142 |
T |
 |
Q |
297 |
taaaggagtaattaagcgaatatt |
320 |
Q |
|
|
|||||||||||||||| ||||||| |
|
|
T |
21311143 |
taaaggagtaattaagggaatatt |
21311166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 320 - 460
Target Start/End: Original strand, 21311525 - 21311665
Alignment:
Q |
320 |
tgattaactgagtacatactaatattatatgacatatatttaattgattatgcaggatgcatgcagatgctttctcattgagagtggtttcgcgctgttc |
419 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||||||||| || ||||| |
|
|
T |
21311525 |
tgattaattgagtacatactaatattatatgacatatattgaattgattatgcaggacgcatgcagatactttctcattgagagtggtttcacgatgttc |
21311624 |
T |
 |
Q |
420 |
gttgcatttctaatcaatgttgcaatgatttatgtgactgg |
460 |
Q |
|
|
||||||||||| ||||||||||||||||||| ||||||||| |
|
|
T |
21311625 |
gttgcatttctgatcaatgttgcaatgatttctgtgactgg |
21311665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 97 - 232
Target Start/End: Original strand, 38350461 - 38350590
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttgggatgtttgggcatata |
196 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||| | | |||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
38350461 |
tgaacatgacgttttgcaaataccccct----ttttgcacttatgtgcaaaatgtctcccaaacttgaaaatttaaatttttgggatgtttgggcatat- |
38350555 |
T |
 |
Q |
197 |
cacaggtgaggaagttggaactgctgatttcaattt |
232 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| |
|
|
T |
38350556 |
-acaggtgaggaagttggaaccactgatttcaattt |
38350590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 487 - 583
Target Start/End: Original strand, 21311662 - 21311758
Alignment:
Q |
487 |
ctggagagaatactgatcgttgcaatgatattacccttgactttgcttctttcattctcctagtttctaatttagttcaatttgcaactattatggt |
583 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||| ||| |||||||||| |||||| |||| ||||||||||||| ||||||||||||||||| |
|
|
T |
21311662 |
ctggagagaatgctgatcgttgcaatgatattacccttaactctgcttctttccttctccaagttcctaatttagttcagtttgcaactattatggt |
21311758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 96 - 175
Target Start/End: Original strand, 32860058 - 32860137
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
32860058 |
atgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
32860137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 96 - 175
Target Start/End: Original strand, 34476168 - 34476247
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
34476168 |
atgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
34476247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6528322 - 6528400
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6528322 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt |
6528400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24318631 - 24318553
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
24318631 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt |
24318553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 29246166 - 29246088
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
29246166 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
29246088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40131149 - 40131227
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
40131149 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt |
40131227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6922801 - 6922722
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6922801 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
6922722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41744855 - 41744777
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
41744855 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt |
41744777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 23466351 - 23466274
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
23466351 |
tgaacatgacgttttgcaaataccccctgaagttttgcagttatgtgcaaaatgccccccaaacttaaaaatttatat |
23466274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 98 - 178
Target Start/End: Complemental strand, 55497225 - 55497145
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
T |
55497225 |
gaacatgaagttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatgttttt |
55497145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 917907 - 917986
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
917907 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
917986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1617974 - 1618053
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
1617974 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttcaaaatttatatt |
1618053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6239083 - 6239004
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6239083 |
tgaacatggcgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
6239004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6259787 - 6259708
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6259787 |
tgaacatggcgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
6259708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 28255282 - 28255361
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
28255282 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
28255361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 30357221 - 30357142
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
30357221 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
30357142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32860618 - 32860539
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
32860618 |
tgaatatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
32860539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 36111614 - 36111689
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
36111614 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatat |
36111689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 37998136 - 37998215
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
37998136 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
37998215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37998745 - 37998666
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
37998745 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
37998666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41790160 - 41790081
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
41790160 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
41790081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 44255342 - 44255261
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata---tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
44255342 |
tgaacatgacgttttgcaaataccctcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
44255261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 50181386 - 50181465
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
50181386 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
50181465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 55083460 - 55083381
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
55083460 |
aacataacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatttt |
55083381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6194255 - 6194333
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6194255 |
tgaacatgacattttgcaaataccccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
6194333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6194861 - 6194783
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6194861 |
tgaacatgacgttttgcaaatagcccctaaagtttttcacttatgtgcaaaatgccccacaaacttaaaaatttatatt |
6194783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 22535937 - 22535855
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
T |
22535937 |
tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatattttt |
22535855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 22731799 - 22731721
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
22731799 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
22731721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 36112197 - 36112120
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
36112197 |
aacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatatttt |
36112120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 47838084 - 47838162
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| | | ||||||| |||||||||||| |
|
|
T |
47838084 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtctcccaaacttaaaaatttatatt |
47838162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 48614051 - 48613973
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
48614051 |
tgaacatgatgttttgcaaataccccctgtagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
48613973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 56279900 - 56279978
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
56279900 |
tgaacatgaagttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
56279978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6259177 - 6259257
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6259177 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
6259257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 6644154 - 6644232
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
6644154 |
aacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgccc--caaacttgaaaatttatattttt |
6644232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 17607685 - 17607605
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
17607685 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
17607605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21659963 - 21659883
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
21659963 |
tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
21659883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 21861352 - 21861432
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
21861352 |
tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
21861432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21861964 - 21861884
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
21861964 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
21861884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 21917213 - 21917293
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
21917213 |
tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
21917293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21917825 - 21917745
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
21917825 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
21917745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 27179928 - 27180008
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
27179928 |
tgaacatgacgttttgcaaataccccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
27180008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 28255892 - 28255812
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
28255892 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
28255812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 30114024 - 30113944
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
30114024 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
30113944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 12594708 - 12594788
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
12594708 |
aacatgatgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttatattttt |
12594788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 21857745 - 21857825
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
T |
21857745 |
aacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatattttt |
21857825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 21913608 - 21913688
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
T |
21913608 |
aacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatattttt |
21913688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 97 - 176
Target Start/End: Complemental strand, 23475873 - 23475793
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaat-gccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||||| ||||||| ||||||||||||| |
|
|
T |
23475873 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatatgcaaaatcgccccccaaacttaaaaatttatattt |
23475793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 171
Target Start/End: Original strand, 1195068 - 1195143
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
T |
1195068 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaattta |
1195143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 17215904 - 17215825
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||| |
|
|
T |
17215904 |
aacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaatttgaaaattcatattttt |
17215825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 18963440 - 18963519
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
18963440 |
tgaacatgacgttttgcaaatacccccctgaagttttgcagttatgtgcaaaatgccccccaaacttaaaaatttatatt |
18963519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 20598828 - 20598907
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
20598828 |
tgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgcaccccaaacttaaaaatttatatt |
20598907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 20599436 - 20599357
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
20599436 |
tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
20599357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 22524435 - 22524513
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||| |||||||||| |||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
22524435 |
aacatgacgttttgcaaataccccctaaagttttgcaattatgtgcaaaatgcccc-cgaacttgaaaatttatattttt |
22524513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30288790 - 30288869
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
30288790 |
tgaacatgacgttttacaaatatccccctgaagttttgcacttatgtgcaaaatgcccccgaaacttaaaaatttatatt |
30288869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30317692 - 30317771
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
30317692 |
tgaacatgacgttttacaaatatccccctgaagttttgcacttatgtgcaaaatgcccccgaaacttaaaaatttatatt |
30317771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32826183 - 32826104
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
32826183 |
tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
32826104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 33821220 - 33821299
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
33821220 |
tgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
33821299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 34825409 - 34825330
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
34825409 |
tgaacatgacgttttgcaaatacacccctgaagttttgcacttatgtgcaaaatgccccccaaactcaaaaatttatatt |
34825330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 103 - 178
Target Start/End: Original strand, 38575681 - 38575755
Alignment:
Q |
103 |
tgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||| |
|
|
T |
38575681 |
tgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatg-ccctcgaacttgaaaatttatattttt |
38575755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 40145781 - 40145856
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||| | ||||||||||||||||| |
|
|
T |
40145781 |
aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaaaatttatat |
40145856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 45895500 - 45895578
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
45895500 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
45895578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 48613443 - 48613522
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| | ||||| |||||||||||| |
|
|
T |
48613443 |
tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgcccccctaacttaaaaatttatatt |
48613522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 50605187 - 50605108
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||| || |||||||||||| |
|
|
T |
50605187 |
atgaacatgacgttttgcaaataccccctgaagttttgcacttatgtacaaaatgccccctaaatttaaaaatttatatt |
50605108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 3886117 - 3886035
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||| || | ||||| ||||||||||||||| |
|
|
T |
3886117 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgctccccgaacttaaaaatttatattttt |
3886035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13994474 - 13994396
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||||| |||| ||||||| ||| |||||||| |
|
|
T |
13994474 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttgtgtgcaaaataccccccaaacttaaaattttatatt |
13994396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23465743 - 23465821
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||| | ||||| |||||||||||| |
|
|
T |
23465743 |
tgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccccgaacttaaaaatttatatt |
23465821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 44254784 - 44254862
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
44254784 |
gaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt |
44254862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 9025099 - 9025022
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| | || |||||||||||||||| |||||||| |||| ||||||||||||||||||| |
|
|
T |
9025099 |
tgaacatgacgttttgcaaatacctccagaagttttgcacttatatgcaaaataccccccaaacttgaaaatttatat |
9025022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 24792481 - 24792404
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| |||| |||||| |
|
|
T |
24792481 |
tgaacgtgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaaattatat |
24792404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 24815780 - 24815857
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| |||| |||||| |
|
|
T |
24815780 |
tgaacgtgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaaattatat |
24815857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 34476780 - 34476700
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
34476780 |
tgaacatgacgttttgcaaatacccccgctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
34476700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 34824807 - 34824886
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||| |||||||||||| |
|
|
T |
34824807 |
tgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgtgtaaaatgcccc-caaacttaaaaatttatatt |
34824886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 50181996 - 50181916
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
50181996 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaatttatatt |
50181916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 51110756 - 51110679
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
51110756 |
aacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccctcaaatttaaaaatttatatt |
51110679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 52346252 - 52346173
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
52346252 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaactt-aaaatttatatt |
52346173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 1862093 - 1862010
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
T |
1862093 |
tgaacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatgttttt |
1862010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 12595360 - 12595280
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
T |
12595360 |
aacatgacattttgcaaatagccccctgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatattttt |
12595280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 12800347 - 12800423
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgc-aaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
12800347 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccgtttaaacttgaaaatttatat |
12800423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 17215070 - 17215150
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
17215070 |
aacatgacgttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatattttt |
17215150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 17971680 - 17971601
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
17971680 |
gaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
17971601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 23475263 - 23475341
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
23475263 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatat |
23475341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 23590612 - 23590692
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
T |
23590612 |
aacatgacgttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgtctcctgaacttgaaaatttatattttt |
23590692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 26477066 - 26476986
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| |||| |||||||||||||||||| |||||||| ||| ||||||| |||||||||||| |
|
|
T |
26477066 |
atgaacatgacgttttgcaaatacccccctgaagttttgcacttatgcgcaaaatgtcccccaaacttaaaaatttatatt |
26476986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30356616 - 30356691
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
30356616 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaat---ccccaaacttaaaaatttatatt |
30356691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 31559866 - 31559787
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| | ||||| ||||||||||||||| |
|
|
T |
31559866 |
aacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatacccc-cgaacttaaaaatttatattttt |
31559787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 34733262 - 34733186
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
34733262 |
aacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat |
34733186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1195677 - 1195598
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| |||||||||||||||| | ||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
1195677 |
tgaacatgacattttgcaaatatccccataaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
1195598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 22535329 - 22535408
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| ||||| |||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
22535329 |
tgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt |
22535408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 22731191 - 22731270
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
22731191 |
tgaacataacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
22731270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24317756 - 24317834
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
24317756 |
tgaacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
24317834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25644786 - 25644865
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||| ||||||||||||||||||| ||||| | |||||||||||| |
|
|
T |
25644786 |
tgaacatgacgttttgcaaatatccccctgaaattttgcgcttatgtgcaaaatgccccccaaacctaaaaatttatatt |
25644865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 27716266 - 27716188
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||| | |||||||||||||||||| |
|
|
T |
27716266 |
tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgaccc-cgaacttgaaaatttatatt |
27716188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 29245560 - 29245638
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
29245560 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-aaaacttaaaaatttatatt |
29245638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38901485 - 38901564
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
38901485 |
tgaacatgatgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccttccaaacttaaaaatttatatt |
38901564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41789323 - 41789401
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
41789323 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgaccc-caaacttaaaaatttatatt |
41789401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 51110182 - 51110260
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
51110182 |
tgaacatgacgttttgcaaatatccccctgaagttttgcatttatgtgcaaaatgcctc-caaacttaaaaatttatatt |
51110260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 56280479 - 56280404
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| ||||||||||||| |||||||||||||||||| || | ||||||||||||||||| |
|
|
T |
56280479 |
aacataacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgctccccgaacttgaaaatttatat |
56280404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 107 - 178
Target Start/End: Complemental strand, 56473724 - 56473653
Alignment:
Q |
107 |
gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||| ||||||||||| | |||||||||||||||| |||| |
|
|
T |
56473724 |
gttttgcaaataccccctgaagttttgcacttatgtacaaaatgccccccgaacttgaaaatttataatttt |
56473653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 1614893 - 1614816
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
1614893 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatat |
1614816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 170
Target Start/End: Complemental strand, 18964050 - 18963976
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
T |
18964050 |
tgaacatgacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaattt |
18963976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 34732682 - 34732760
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || ||||||||||| |
|
|
T |
34732682 |
tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaagttaaaaatttatat |
34732760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38902092 - 38902014
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| |||||||||||||||||||||||||| ||||||||||||||| ||||| ||| ||||||| |||||||||||| |
|
|
T |
38902092 |
tgaatatgacgttttgcaaatatcccctgaaattttgcacttatgtggcaaatgtcccccaaacttaaaaatttatatt |
38902014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13966831 - 13966911
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| | | |||||||||| |
|
|
T |
13966831 |
tgaacatgacgttttgcaaatatcccccctgaagttttgcatttatgtgcaaaatgccccccaaacataataatttatatt |
13966911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13993861 - 13993945
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc------tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
13993861 |
tgaacatgacgttttgcaaataccccccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
13993945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 26763312 - 26763232
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| || |||||||||||||||||||||||||| || | | ||||||||||||||||||||| |
|
|
T |
26763312 |
tgaacatgacgttttgcaaatacccattgaagttttgcacttatgtgcaaaataccac-cgaacttgaaaatttatattttt |
26763232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 27180539 - 27180459
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
27180539 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcctccaaacttcaaaatttatatt |
27180459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 101 - 178
Target Start/End: Original strand, 29342580 - 29342657
Alignment:
Q |
101 |
catgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||| || |||||| | | ||||||| ||||||||||||||| |
|
|
T |
29342580 |
catgacgttttgcaaataccccctgaagttttgcacttatatgtaaaatgtctcccaaacttaaaaatttatattttt |
29342657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 29761503 - 29761582
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
29761503 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtccc-caaacttaaaaatttatatt |
29761582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 173
Target Start/End: Complemental strand, 47838822 - 47838746
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata |
173 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| ||||||| |||||||||| |
|
|
T |
47838822 |
tgaacatgacgttttgcaaatacccctctgaagtttttcacttatgtgcaaaatgcccc-caaacttaaaaatttata |
47838746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 6076921 - 6076997
Alignment:
Q |
99 |
aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| ||||||||||||| ||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
6076921 |
aacatgatgttttgcaaatattcccctgaagttttgcgcttatgtgcaaaatgacccataaacttgaaaatttatat |
6076997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 7390071 - 7389995
Alignment:
Q |
99 |
aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| ||||||||||||| ||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
7390071 |
aacatgatgttttgcaaatattcccctgaagttttgcgcttatgtgcaaaatgacccataaacttgaaaatttatat |
7389995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 152
Target Start/End: Complemental strand, 7972896 - 7972840
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgcc |
152 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
7972896 |
tgaacatgacgttttgcaaatatccctctgaagttttgcacttatgtgcaaaatgcc |
7972840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 23161231 - 23161311
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||| ||| ||||||| |
|
|
T |
23161231 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaattttttattttt |
23161311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 39333513 - 39333593
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||| |||||||||||| ||||| ||||||||||||| || ||||| |
|
|
T |
39333513 |
aacatgacgttttgcaaatatccccctgaagttttgcagttatgtgcaaaacgccccctaaacttgaaaattcattttttt |
39333593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 47309170 - 47309094
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| || ||||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
47309170 |
aacatgatgttttgcaaatactctcctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat |
47309094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 48800380 - 48800301
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||||| |
|
|
T |
48800380 |
tgaacatgaagttttgcaaatacaccccctgaagttttgcacttatgtgcaaaatgctccccaaacttaaaaatttatat |
48800301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 56443264 - 56443337
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| ||||| |||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
56443264 |
aacatgatgttttgcaaataccccctcaagttttgtacttatgtgcaaaatgccccg--aacttgaaaatttatat |
56443337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 918515 - 918437
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||| ||||||| |||| |||||||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
918515 |
tgaacatgacgtttcgcaaatacccccctgaagttttgcacttatgtgcaaaatgctcc-caaacttaaaaatttatatt |
918437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 6644883 - 6644804
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| | | ||||| ||||||||| ||||| |
|
|
T |
6644883 |
aacatgacgttttgcaaatactccctgaagttttgcacttatgtgcaaaatgctctccgaacttaaaaatttatgttttt |
6644804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13967714 - 13967635
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| || || ||||||||||||||| ||||||||| ||| ||||||| |||||||||||| |
|
|
T |
13967714 |
tgaacatgacgttttgcaaatattcctctaaagttttgcacttatatgcaaaatgtcccccaaacttaaaaatttatatt |
13967635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 23161940 - 23161866
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
23161940 |
aacataacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgcccc-cgaactttaaaatttatat |
23161866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26476460 - 26476538
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||| |||||||||| | ||||| |||||||||||| |
|
|
T |
26476460 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgtaaaatgcccc-ccaacttaaaaatttatatt |
26476538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 29617539 - 29617464
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||| |||||| ||| |||| ||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
T |
29617539 |
aacatgacgtttttcaaataccccatgaaattttgcacttatgtgcaaaataccccttaaacttgaaaatttatat |
29617464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 101 - 175
Target Start/End: Complemental strand, 29762377 - 29762302
Alignment:
Q |
101 |
catgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||| |||| ||||||||||||||||||||||| ||||||| |||||| |||||||||||| |
|
|
T |
29762377 |
catgacgttttgcaaatacccccctgaagttttgcacttatgtgcaagatgccccctaaacttaaaaatttatatt |
29762302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 31559167 - 31559218
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
31559167 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgttcaaaatg |
31559218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 37687740 - 37687663
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
37687740 |
aacataacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaactttaaaatttatatt |
37687663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 40132478 - 40132423
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
40132478 |
cccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
40132423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 41611431 - 41611356
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
41611431 |
aacatgacgttttgcaaataccccttgaagttttgcacttatgtgcaaaatgccatccgaacttaaaaatttatat |
41611356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42592043 - 42592122
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||||||||||||| | ||| |||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
42592043 |
tgaaaatgacgttttgcaaaaaccccgctgaagttttgcacttatgtgcaaaatgacccccaaacttaaaaatttatatt |
42592122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42593537 - 42593458
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| | || |||||||||||||||||||||||||| ||||||| ||| |||||||| |
|
|
T |
42593537 |
tgaacatgacgttttgcaaataccccccttaaattttgcacttatgtgcaaaatgccccccaaacttaaaagtttatatt |
42593458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 50604578 - 50604657
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||| ||||| || || ||||||| |||||||||||| |
|
|
T |
50604578 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtacaaaacgctccccaaacttaaaaatttatatt |
50604657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 55496646 - 55496724
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| |||||| ||||| ||||||||||||| |||||||||||||||||| || | ||||||||||||||||||||| |
|
|
T |
55496646 |
aacatgatgttttgtaaata-cccctgaagttttacacttatgtgcaaaatgctcctcgaacttgaaaatttatattttt |
55496724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 56444178 - 56444100
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
56444178 |
aacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctc-taaacttgaaaatttatatttt |
56444100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 17971110 - 17971168
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
T |
17971110 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc |
17971168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24791624 - 24791702
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| || ||||||||||| |||||||||||||| |||| || |||||||||||| |
|
|
T |
24791624 |
tgaacatgacgttttgcaaatacccccctaaattttgcacttacgtgcaaaatgcccctcaaatttaaaaatttatatt |
24791702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24816637 - 24816559
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| || ||||||||||| |||||||||||||| |||| || |||||||||||| |
|
|
T |
24816637 |
tgaacatgacgttttgcaaatacccccctaaattttgcacttacgtgcaaaatgcccctcaaatttaaaaatttatatt |
24816559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 32464951 - 32465008
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
32464951 |
cccctgaagttttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttatattttt |
32465008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 42259415 - 42259493
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||||||||||| |||||| |||| ||| ||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
T |
42259415 |
aacatgacgttttacaaataccccccgaaattttgcactcatgtgcaaaatgccccatgaacttgaaaatttatatttt |
42259493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 165
Target Start/End: Original strand, 45764641 - 45764707
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaa |
165 |
Q |
|
|
|||||||||||||||| ||| |||||||||||||||| |||||||||| ||||||| |||||||||| |
|
|
T |
45764641 |
aacatgacgttttgcagataccccctgaagttttgcagttatgtgcaacatgccccccaaacttgaa |
45764707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 45765625 - 45765568
Alignment:
Q |
99 |
aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
45765625 |
aacatgacgttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgcccc |
45765568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 47308614 - 47308668
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
47308614 |
cccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
47308668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 105 - 174
Target Start/End: Original strand, 6507615 - 6507683
Alignment:
Q |
105 |
acgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||| | ||||| ||||||||||| |
|
|
T |
6507615 |
acgttttgcaaataccccctgaagttttgcacttatgtgcaaaaagcccc-cgaacttaaaaatttatat |
6507683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 19170284 - 19170219
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
T |
19170284 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttagattttt |
19170219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 102 - 178
Target Start/End: Original strand, 25705401 - 25705478
Alignment:
Q |
102 |
atgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||| |||| ||||||||||||||||||||||||| | | | | ||||||||||||||||||||| |
|
|
T |
25705401 |
atgacgttttgcaaatacccccgtgaagttttgcacttatgtgcaaaaagtctcccgaacttgaaaatttatattttt |
25705478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 159
Target Start/End: Original strand, 26171811 - 26171875
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaa |
159 |
Q |
|
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
26171811 |
tgaacatgaagttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgccccccaaa |
26171875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 113 - 174
Target Start/End: Complemental strand, 42987999 - 42987938
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||| || ||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
42987999 |
caaataccctctgaaattttgcacttatgtgcaaaatgccccgtaaacttgaaaatttatat |
42987938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 52177344 - 52177265
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
52177344 |
aacatggcgttttgcaaataaccccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaaatttatatt |
52177265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 21858443 - 21858367
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| ||||| ||| |||||||||||| |||||||||| || ||||||||||||||||||| |
|
|
T |
21858443 |
aacatgatgttttgcaaatacccccttgaaattttgcacttatatgcaaaatgcaccccaaacttgaaaatttatat |
21858367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 21914306 - 21914230
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| ||||| ||| |||||||||||| |||||||||| || ||||||||||||||||||| |
|
|
T |
21914306 |
aacatgatgttttgcaaatacccccttgaaattttgcacttatatgcaaaatgcaccccaaacttgaaaatttatat |
21914230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 101 - 174
Target Start/End: Complemental strand, 29861029 - 29860954
Alignment:
Q |
101 |
catgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||| || ||||||||||| ||||||||||||||||||| | | ||||||||||||||||| |
|
|
T |
29861029 |
catgacgttttgcaaataccctccctgaagttttacacttatgtgcaaaatgcctcccgaacttgaaaatttatat |
29860954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 35194842 - 35194790
Alignment:
Q |
102 |
atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
T |
35194842 |
atgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgcccc |
35194790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 48083079 - 48083159
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||| || || ||||||||||||||| |
|
|
T |
48083079 |
aacatgacgtcttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctgaatttaaaaatttatattttt |
48083159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 172
Target Start/End: Complemental strand, 1618580 - 1618506
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||| |||| ||||||||| ||| ||||||| ||||||||| |
|
|
T |
1618580 |
tgaacatgacgttttgcaaata-cccctgaagttttgcgcttacgtgcaaaatatcccccaaacttaaaaatttat |
1618506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 7862002 - 7862077
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||| |||||||||||||| |||||||||| ||| | ||||| ||||||||||| |
|
|
T |
7862002 |
aacatgacactttgcaaatatcccctaaagttttgcacttacgtgcaaaatgtcccccgaacttaaaaatttatat |
7862077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 9024717 - 9024796
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| || || |||||| |||||||||||||| |||||||| ||||||| |||||||||||| |
|
|
T |
9024717 |
tgaacatgatgttttgcaaataccctcttgaagttatgcacttatgtgcataatgccccccaaacttaaaaatttatatt |
9024796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 9360495 - 9360440
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| | ||||||||||| ||||||||||||||||||||| |
|
|
T |
9360495 |
aacatgacgttttgcaaatacctcctgaagttttacacttatgtgcaaaatgcccc |
9360440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 21312153 - 21312073
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||| ||||| |||| |||||||||||||||||||| ||||| ||||| ||| ||||||||||||||||| |
|
|
T |
21312153 |
tgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgtaaaataccccg--aacatgaaaatttatattttt |
21312073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 36870234 - 36870307
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
36870234 |
aacataacgttttgcaaataccccctgaagtttt-cacttatgtgcaaaatgcccc-cgaactttaaaatttatat |
36870307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 36870934 - 36870879
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||| |||| ||||||||||||| |
|
|
T |
36870934 |
aacatgacgttttgcaaataccccctgaagttttgcatttatatgcaaaatgcccc |
36870879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 37302508 - 37302563
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||| |||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
T |
37302508 |
aacatgatgttttgcaaatagcccctgaagttttgcagttatgtgcaaaatgcccc |
37302563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 48083975 - 48083896
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| | ||||||||||||||||| |||||||||| || | || |||||||||||||||||| |
|
|
T |
48083975 |
aacatgacgttttgcaaatacctcctgaagttttgcacttgtgtgcaaaatacctcatgaatttgaaaatttatattttt |
48083896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 48799796 - 48799870
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||| ||||||| ||||||||| ||||||||| | | ||||||||||||||||| |
|
|
T |
48799796 |
aacatgacgttttgcaaata-ccccttaagttttacacttatgtacaaaatgcctcccgaacttgaaaatttatat |
48799870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 1861509 - 1861586
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||| |||||||||||||||| ||| | ||||||||||||||||| |
|
|
T |
1861509 |
aacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaatttcccccgaacttgaaaatttatat |
1861586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 23519455 - 23519534
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc----tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
23519455 |
aacatgaagttttgcaaatacccccctcctgaagttttgcacttatgtgcaaaatgcccccaaaatttgaaaatttatat |
23519534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 105 - 174
Target Start/End: Complemental strand, 25706056 - 25705986
Alignment:
Q |
105 |
acgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||| ||||| |||||||||||||||||||||||||| | | | ||||||||||||||||| |
|
|
T |
25706056 |
acgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgtctcccgaacttgaaaatttatat |
25705986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 153
Target Start/End: Original strand, 29616853 - 29616907
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccc |
153 |
Q |
|
|
|||||||||||||||||||| ||| | |||||||||||||||||||||||||||| |
|
|
T |
29616853 |
aacatgacgttttgcaaataccccataaagttttgcacttatgtgcaaaatgccc |
29616907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 29860065 - 29860142
Alignment:
Q |
99 |
aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| || |||||||||||||||||| ||||||||||| | | ||||||||||||||||| |
|
|
T |
29860065 |
aacatgacgttttgcaaatacatctcctgaagttttgcacttacgtgcaaaatgcatctcgaacttgaaaatttatat |
29860142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 30318479 - 30318401
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| | ||||||||||| |||||||||||||||||||| | ||| |||||||||||| |
|
|
T |
30318479 |
tgaacatgacgttttgcaaatacctcctgaagttttatacttatgtgcaaaatgccccctagactaaaaaatttatatt |
30318401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 36927576 - 36927634
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
36927576 |
cccctgaaattttgcacttatgtgcaaaatgccccataaatttgaaaatttatattttt |
36927634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 38392184 - 38392242
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
T |
38392184 |
cccctgaaattttgcacttatgtgcaaaatggcccctaaacttgaaaatttatattttt |
38392242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 39633525 - 39633467
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
39633525 |
cccccgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttatattttt |
39633467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 40278402 - 40278460
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
T |
40278402 |
cccctgaaattttgcacttatgtgcaaaatgctccctaaacttgaaaatttatattttt |
40278460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 99 - 172
Target Start/End: Complemental strand, 29798109 - 29798037
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
||||||| |||||||||||| ||||| ||||||| ||||||||||||||||||||| | ||| ||||||||||| |
|
|
T |
29798109 |
aacatgatgttttgcaaataccccctaaagttttacacttatgtgcaaaatgcccc-cgaacatgaaaatttat |
29798037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 30289576 - 30289519
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||||| | ||||||||||| |||||||||||||||||||| |
|
|
T |
30289576 |
tgaacatgacgttttgcaaatacctcctgaagttttatacttatgtgcaaaatgcccc |
30289519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 120 - 177
Target Start/End: Original strand, 36076691 - 36076748
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
T |
36076691 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatttt |
36076748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 38035736 - 38035671
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
38035736 |
caaataccccctgaaattttgcacttatgtgcaaaatgccctctaaacttaaaaatttatattttt |
38035671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 109 - 178
Target Start/End: Complemental strand, 40220810 - 40220742
Alignment:
Q |
109 |
tttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||| |||||||||||||||||||| || ||||||| ||| | ||||||||||||||||||||| |
|
|
T |
40220810 |
tttgcaaata-cccctgaagttttgcacttacgtacaaaatgtcccccgaacttgaaaatttatattttt |
40220742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 1613581 - 1613657
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| |||| |||||||||| |||||||||||||||||| | ||||||||||||||||| |
|
|
T |
1613581 |
aacatgaggttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgcctcctgaacttgaaaatttatat |
1613657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 6337022 - 6336946
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||| |||||| || |||||||||||| |||||| ||||||||||||| ||||||||||||||||| |
|
|
T |
6337022 |
aacatgacgtttttcaaataccctcctgaagttttgtacttatatgcaaaatgccccctgaacttgaaaatttatat |
6336946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 103 - 174
Target Start/End: Original strand, 9359727 - 9359799
Alignment:
Q |
103 |
tgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||| || ||||||||||| ||||||||| ||||||||| |||||||||||||||||| |
|
|
T |
9359727 |
tgacgttttgcaaatattcctctgaagttttgaacttatgtgtaaaatgccctttaaacttgaaaatttatat |
9359799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 15030956 - 15031033
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||| |||| || || ||||||||| |
|
|
T |
15030956 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgc--aatgccccccaaatttaaatatttatatt |
15031033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 26172379 - 26172323
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
T |
26172379 |
aacatgacgttttgcaaataaccccctgaagttttacacttatgtgcaaaatgcccc |
26172323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 39334376 - 39334324
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
T |
39334376 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg |
39334324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 15739651 - 15739577
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| || ||||||| ||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
15739651 |
aacataacattttgcagata-ccccggaagttttgcacttatgtgcaaaatgccccttgaacttgaaaatttatat |
15739577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 25490182 - 25490128
Alignment:
Q |
102 |
atgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
T |
25490182 |
atgacgttttgcaaatacccccactgaagttttgcacttatgtgcaaaatgcccc |
25490128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 32825564 - 32825643
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| ||||| || |||||||||||| |||||||||| || | || || |||||||||||| |
|
|
T |
32825564 |
tgaacatgacgttttgcaaatatccccctaaaattttgcacttatatgcaaaatgctcctcgaatttaaaaatttatatt |
32825643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 174
Target Start/End: Complemental strand, 42260266 - 42260192
Alignment:
Q |
102 |
atgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||| |||| |||||||||||||||||||||||||| |||| || |||||||||||||| |
|
|
T |
42260266 |
atgacgttttgcaaataccccccttgaagttttgcacttatgtgcaaaataccccctgaatttgaaaatttatat |
42260192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 43420737 - 43420662
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| ||||||||||||| ||||| |||||| |||||||||||||||||| || | ||||||||||||||||| |
|
|
T |
43420737 |
aacatcacgttttgcaaatcccccctatagttttacacttatgtgcaaaatgctccccgaacttgaaaatttatat |
43420662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 44097792 - 44097870
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| |||||| |||||||||||||| ||||||||||||||||| | | ||||||||||||| ||||||| |
|
|
T |
44097792 |
aacatgacgtttgacaaataccccctgaagttttgtacttatgtgcaaaatgcttc-cgaacttgaaaatttgtattttt |
44097870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 54284030 - 54283975
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
54284030 |
ctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt |
54283975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 4630660 - 4630738
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccc-cgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||| ||| ||||||||||||| ||||||||||||||||| | ||| ||||||||||||||| |
|
|
T |
4630660 |
aacatgatgttttgcaaatacccctctgaagttttgcatttatgtgcaaaatgccctctgaaatttgaaaatttatatt |
4630738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 4941069 - 4940987
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||||||||||| ||||| || || ||||||||||||||||||| |||||| ||| | ||||| ||||||||||||||| |
|
|
T |
4941069 |
tgaatatgacgttttgtaaataccctcttgaagttttgcacttatgtgtaaaatgtcccccgaacttaaaaatttatattttt |
4940987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 101 - 174
Target Start/End: Complemental strand, 7862891 - 7862817
Alignment:
Q |
101 |
catgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||| |||| |||||| ||||| |||||||| ||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
7862891 |
catgacattttacaaatacccccttgaagttttacacttatgtgcaaaatgtcccctaaacttgaaaatttatat |
7862817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 36077213 - 36077155
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
36077213 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
36077155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 36928399 - 36928341
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
36928399 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
36928341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 40034308 - 40034254
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| || |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
40034308 |
cccctaaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttatat |
40034254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 40279216 - 40279158
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
40279216 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
40279158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 41904671 - 41904617
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||| | |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
41904671 |
cccctggaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat |
41904617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 42341856 - 42341914
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||| |||||||||||||||| |||| |||||||||||||||||||||| |
|
|
T |
42341856 |
cccctgaaattttacacttatgtgcaaaataccccctaaacttgaaaatttatattttt |
42341914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 55082568 - 55082645
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||| |||||||||||||||||| | |||||| |||||||||| |
|
|
T |
55082568 |
aacatgacgttttgcaaataccccccctgaagttttgtacttatgtgcaaaatgccacctgaacttggaaatttatat |
55082645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 119 - 172
Target Start/End: Complemental strand, 1565885 - 1565832
Alignment:
Q |
119 |
tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
||||||| | |||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
1565885 |
tcccctggaattttgcacttatgtgcaaaatgccccataaacttgaaaatttat |
1565832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 178
Target Start/End: Complemental strand, 22072828 - 22072752
Alignment:
Q |
102 |
atgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||| | || | |||||||||||||||||||||||||| ||| |||||| ||||||||||||||| |
|
|
T |
22072828 |
atgacgttttgcaaatcttcctttgaagttttgcacttatgtgcaaaatg-ccctaaaacttaaaaatttatattttt |
22072752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 12213358 - 12213278
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| || ||||||||||| ||| ||||||||||| ||||||||||||||| ||| | | ||||||||||||||||||| |
|
|
T |
12213358 |
aacatcacattttgcaaatacccctatgaagttttgcccttatgtgcaaaatgtcccccgagcttgaaaatttatattttt |
12213278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 120 - 168
Target Start/End: Complemental strand, 19538420 - 19538372
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaat |
168 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
T |
19538420 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaat |
19538372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 23520026 - 23519974
Alignment:
Q |
122 |
cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| |||||||| | ||||||||||| ||||||| |
|
|
T |
23520026 |
cctgaagttttgcacttatgtgtaaaatgcctcccaaacttgaaagtttatat |
23519974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 53139928 - 53139872
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||| |||||||||||||| |||| | ||||||||||||||||||||||||||||| |
|
|
T |
53139928 |
aacataacgttttgcaaatactcccttaaagttttgcacttatgtgcaaaatgcccc |
53139872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 161
Target Start/End: Complemental strand, 6508437 - 6508374
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaact |
161 |
Q |
|
|
||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||| |
|
|
T |
6508437 |
aacataacgttttgcaaatatttacctgaagttttgcacttatgtgcaaaatgtcccccaaact |
6508374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 10663733 - 10663651
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctga-agttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||||||||||||||||| |||| | ||||||| |||||||||||||||||| | | ||||| ||| ||||||||||| |
|
|
T |
10663733 |
tgaatatgacgttttgcaaatacccccctacagttttgaacttatgtgcaaaatgcctcccgaacttaaaagtttatattttt |
10663651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 10877878 - 10877796
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctga-agttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||||||||||||||||| |||| | ||||||| |||||||||||||||||| | | ||||| ||| ||||||||||| |
|
|
T |
10877878 |
tgaatatgacgttttgcaaatacccccctacagttttgaacttatgtgcaaaatgcctcccgaacttaaaagtttatattttt |
10877796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 19537877 - 19537935
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| | |||| |||||||| |||||| |
|
|
T |
19537877 |
cccctgaaattttgcacttatgtgcaaaatgccccttatacttaaaaatttagattttt |
19537935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 30779079 - 30779133
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |
|
|
T |
30779079 |
cccctgaagttttgcacttaagtgcaaaatgccccctcaacttgaaattttatat |
30779133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 34016953 - 34017011
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||||||||||||||| || |||||| |||||||| |||||| |
|
|
T |
34016953 |
cccctgaaattttgcacttatgtgcaaaatgctccctaaacttaaaaatttagattttt |
34017011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 150
Target Start/End: Complemental strand, 38351628 - 38351574
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
||||||||||||||| ||||||||| | |||||||||| |||||||||||||||| |
|
|
T |
38351628 |
tgaacatgacgttttacaaatatcctcatgaagttttgtacttatgtgcaaaatg |
38351574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 39632708 - 39632766
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||| | |||||| |||||||| |||||| |
|
|
T |
39632708 |
cccctgaaattttgcacttatgtgcaaaatgcctcataaacttaaaaatttagattttt |
39632766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 40146354 - 40146296
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||||| ||||||||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
T |
40146354 |
tgaacatgaaattttgcaaatacccccctgaagtttttcacttatgtgcaaaatgcccc |
40146296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 6955700 - 6955757
Alignment:
Q |
121 |
ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| ||||||||||||||||||| |||||| |||||| |||||||| |||||| |
|
|
T |
6955700 |
ccctgaaattttgcacttatgtgcaaattgccccctaaacttaaaaatttagattttt |
6955757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 101 - 174
Target Start/End: Original strand, 23395965 - 23396037
Alignment:
Q |
101 |
catgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||| |||| | |||||||||||||||| || ||||||| | | | ||||||||||||||||| |
|
|
T |
23395965 |
catgacgttttgcaa-tatctcttgaagttttgcacttacgtacaaaatgtctcccgaacttgaaaatttatat |
23396037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 38035162 - 38035227
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| ||||||||||||| |||||||| ||| |||||| |||||||| |||||| |
|
|
T |
38035162 |
caaataccccctgaaattttgcacttatgcgcaaaatgtcccataaacttaaaaatttagattttt |
38035227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 38393015 - 38392950
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| ||||||||||||||| ||||||| || |||||| |||||||| |||||| |
|
|
T |
38393015 |
caaataccccctgaaattttgcacttatgtgaaaaatgctccctaaacttaaaaatttagattttt |
38392950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 97 - 148
Target Start/End: Original strand, 7972029 - 7972081
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaa |
148 |
Q |
|
|
|||||||||||||||| ||| | | |||||||||||||||||||||||||||| |
|
|
T |
7972029 |
tgaacatgacgttttgtaaacaccgccctgaagttttgcacttatgtgcaaaa |
7972081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 106 - 178
Target Start/End: Complemental strand, 55778198 - 55778126
Alignment:
Q |
106 |
cgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||| || |||| || ||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
T |
55778198 |
cgttttgcaaataccctttgaaattctgcacttatgtgcaaaatgtctcctgaacttgaaaatttatattttt |
55778126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 106 - 178
Target Start/End: Complemental strand, 55842378 - 55842306
Alignment:
Q |
106 |
cgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||| || |||| || ||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
T |
55842378 |
cgttttgcaaataccctttgaaattctgcacttatgtgcaaaatgtctcctgaacttgaaaatttatattttt |
55842306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 135
Target Start/End: Complemental strand, 56473753 - 56473717
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgca |
135 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||| |
|
|
T |
56473753 |
aacatgacgttttgcaaataccccctgaagttttgca |
56473717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 205128 - 205069
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttg-aaaatttatattttt |
178 |
Q |
|
|
||||| || |||||||||||||||||||||| ||| ||||||| ||||||||||||||| |
|
|
T |
205128 |
cccctaaaattttgcacttatgtgcaaaatgtcccttaaacttgaaaaatttatattttt |
205069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 171
Target Start/End: Original strand, 1565099 - 1565150
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
|||||||| ||||||||||||||| |||||||||| |||||| |||||||| |
|
|
T |
1565099 |
cccctgaaattttgcacttatgtgtaaaatgccccttaaacttaaaaattta |
1565150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 167
Target Start/End: Original strand, 6450251 - 6450298
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa |
167 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||| |
|
|
T |
6450251 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaactttaaaa |
6450298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 167
Target Start/End: Original strand, 19169452 - 19169499
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa |
167 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||| |
|
|
T |
19169452 |
cccctgaaattttgcacttatgtgcaaaatgccccataaactttaaaa |
19169499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 100 - 174
Target Start/End: Original strand, 43419716 - 43419787
Alignment:
Q |
100 |
acatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||| ||||||| |||||| |||| ||||||||||||||| |||||||||||||| ||||| ||||||||||| |
|
|
T |
43419716 |
acattacgttttacaaatactccctaaagttttgcacttat-tgcaaaatgccccg--aactttaaaatttatat |
43419787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 220774 - 220720
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||| |||||||||| |||||| |
|
|
T |
220774 |
cccctgaaattttgcacttatgtgcaaaatgtcccttgaacttgaaaaattatat |
220720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 112 - 174
Target Start/End: Complemental strand, 33617546 - 33617484
Alignment:
Q |
112 |
gcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| || ||||||||||||| ||||||||||||||||| ||||| ||||||||||| |
|
|
T |
33617546 |
gcaaataccctctgaagttttgcatttatgtgcaaaatgcccactgaacttaaaaatttatat |
33617484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 35194149 - 35194226
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| || | ||||||||||||||||| |||||||| | || ||||||||||||||||| |
|
|
T |
35194149 |
aacatgatgttttgcaaataccctccttgaagttttgcacttatatgcaaaatactccctgaacttgaaaatttatat |
35194226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 154
Target Start/End: Original strand, 40033483 - 40033517
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |
|
|
T |
40033483 |
cccctgaaattttgcacttatgtgcaaaatgcccc |
40033517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 42342542 - 42342484
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||| |||||||||||||||| ||| |||||| |||||||| |||||| |
|
|
T |
42342542 |
cccctgaaattttgaacttatgtgcaaaatgtcccataaacttaaaaatttaaattttt |
42342484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 54445503 - 54445449
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| |||||||||||||||||||||| ||| |||||| |||||||| |||||| |
|
|
T |
54445503 |
tgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaatttagattttt |
54445449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 153
Target Start/End: Complemental strand, 6956219 - 6956186
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccc |
153 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| |
|
|
T |
6956219 |
cccctgaaattttgcacttatgtgcaaaatgccc |
6956186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 174
Target Start/End: Complemental strand, 32465518 - 32465469
Alignment:
Q |
125 |
gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||| |||||||||||| | ||||||||||||||||| |
|
|
T |
32465518 |
gaagttttgaacttataagcaaaatgccccccgaacttgaaaatttatat |
32465469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 171
Target Start/End: Original strand, 41610682 - 41610746
Alignment:
Q |
107 |
gttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
|||||||||||| |||| |||| |||| ||||||||||||||||| ||| ||||||| |||||||| |
|
|
T |
41610682 |
gttttgcaaatacccccctgaaatttttcacttatgtgcaaaatgtcccccaaactt-aaaattta |
41610746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #244
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 41904123 - 41904183
Alignment:
Q |
119 |
tcccctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| |||| ||||||||||||||||| |||| |||||| |||||||| |||||| |
|
|
T |
41904123 |
tcccctgaaattttacacttatgtgcaaaatgcccccataaacttaaaaatttagattttt |
41904183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #245
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 42987160 - 42987224
Alignment:
Q |
114 |
aaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||| |||| |||||| |||||||||||| | |||||| |||||||| |||||| |
|
|
T |
42987160 |
aaataccccctgaaattttacacttacgtgcaaaatgcctcttaaacttaaaaatttagattttt |
42987224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 172; Significance: 4e-92; HSPs: 235)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 4e-92
Query Start/End: Original strand, 320 - 583
Target Start/End: Complemental strand, 40126094 - 40125828
Alignment:
Q |
320 |
tgattaactgagtacatactaatattatatgacatatattt--aattgattatgcaggatgcatgcagatgctttctcattgagagtggtttcgcgctgt |
417 |
Q |
|
|
||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
T |
40126094 |
tgattaattgagtacatcctaatattatatgacatatatttttaattgattatgcaggatgcatgcagatactttctcattgagagtggtttcgcgttgt |
40125995 |
T |
 |
Q |
418 |
tcgttgcatttctaatcaatgttgcaatgatttatgtgactggtactgtttgcaaagctgatgatacttctggagagaatactgatcgttgcaatgatat |
517 |
Q |
|
|
| ||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||||||| ||||||||||||| |||||||||||||||||| |
|
|
T |
40125994 |
ttgttgcatttctaatcaatgttgcaatgatttctgtgactggcactgtttgcaaggctgatgatatttctggagagaatgttgatcgttgcaatgatat |
40125895 |
T |
 |
Q |
518 |
tacccttgactttgcttctttcattctcctagtttctaatttagttc-aatttgcaactattatggt |
583 |
Q |
|
|
||||||| ||| ||||||||| |||||| ||| |||||||||||| |||||||||||||||||| |
|
|
T |
40125894 |
tacccttaactccgcttctttccttctccaggttcctaatttagttcgcatttgcaactattatggt |
40125828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 174 - 309
Target Start/End: Complemental strand, 40126571 - 40126446
Alignment:
Q |
174 |
tttttgggatgtttgggcatatacacaggtgaggaagttggaactgctgatttcaatttcaattctagtatttgtaatggcggcatgtttctttggtgaa |
273 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
T |
40126571 |
tttttgggatgtttgggcata----caggtgaggaagttggaactgctgatttcaatt------ctagtatttgtaatggctgcatgtttctttggtgaa |
40126482 |
T |
 |
Q |
274 |
ttgagctatggaaaaccccctcctaaaggagtaatt |
309 |
Q |
|
|
|||||||||| |||||||||| |||||||||||||| |
|
|
T |
40126481 |
ttgagctatgtaaaaccccctgctaaaggagtaatt |
40126446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39669535 - 39669457
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
39669535 |
tgaacatgacgttttacaaatatcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
39669457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 43727765 - 43727687
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
43727765 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttatatt |
43727687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 35154026 - 35154104
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
35154026 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
35154104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36027982 - 36027905
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36027982 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
36027905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13737704 - 13737624
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
13737704 |
tgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgtgcaaaatgccccccaaacttcaaaatttatatt |
13737624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 31585957 - 31586037
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
31585957 |
tgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
31586037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 97 - 176
Target Start/End: Original strand, 9718048 - 9718128
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
T |
9718048 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattt |
9718128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 883510 - 883589
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||| |
|
|
T |
883510 |
tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgtaaaatgccccccaaacttaaaaatttatatt |
883589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 884119 - 884040
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
884119 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
884040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 3370748 - 3370669
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
3370748 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
3370669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 10120646 - 10120567
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
10120646 |
tgaacatgacgttttgcaaatactccccagaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
10120567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13341729 - 13341808
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
13341729 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
13341808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17053294 - 17053373
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
17053294 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt |
17053373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 20495436 - 20495515
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
20495436 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
20495515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 23323952 - 23323873
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
23323952 |
tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
23323873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 23781747 - 23781668
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
23781747 |
tgaacatgacgttttgcaaatatccccctcaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
23781668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24828233 - 24828154
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
24828233 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
24828154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32950968 - 32950889
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
32950968 |
tgaacatgacattttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
32950889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 44518388 - 44518467
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
44518388 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
44518467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 52171671 - 52171592
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
52171671 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
52171592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 23323342 - 23323420
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
23323342 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
23323420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36260111 - 36260033
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36260111 |
tgaatatgacgttttgcaaatactccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt |
36260033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36736010 - 36736088
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || ||||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36736010 |
tgaacatgacgttttgcaaataccctctgaatttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
36736088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37704328 - 37704250
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
37704328 |
tgaacatgacattttgcaaataccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
37704250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 40783393 - 40783315
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| ||||||| ||| |||||||| |
|
|
T |
40783393 |
tgaacatgacgttttgcaaatatcccccgaaattttgcacttatgtgcaaaatgccccccaaacttaaaagtttatatt |
40783315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42248945 - 42248867
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| | ||||| |||||||||||| |
|
|
T |
42248945 |
tgaacatgacgttttgcaaataccccctaaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatatt |
42248867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 44518996 - 44518918
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| |||||||||||||||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
44518996 |
tgaacatgacattttgcaaataccccctgaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttatatt |
44518918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 54602262 - 54602340
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
54602262 |
aacataacgttttgtaaatatcccccgaagttttgcacttatgtgcaaaatgccccataaacttgaaaatttatatttt |
54602340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 5152507 - 5152587
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
5152507 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
5152587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 9103955 - 9103878
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
9103955 |
tgaacatgaaattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
9103878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23581856 - 23581936
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||| |||||||||||| |
|
|
T |
23581856 |
tgaacatgacgttttgcaaatatcccctctgaagttttgcacttatgtgcaaactgccccccaaacttaaaaatttatatt |
23581936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24086837 - 24086757
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
24086837 |
tgaacatgacgttttgcaaataccctccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
24086757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36736619 - 36736539
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36736619 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
36736539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 11652989 - 11653069
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| | |||||||||||||||| |||| |
|
|
T |
11652989 |
aacatgacgttttgcaaatactcccctgaagtttttcacttatgtgcaaaatgccccccgaacttgaaaatttataatttt |
11653069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 50672576 - 50672496
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
50672576 |
aacatgacgttttgcaaatatccccctgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaatttatattttt |
50672496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4238329 - 4238251
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||| |||||||||||| |
|
|
T |
4238329 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgcccc-cacacttaaaaatttatatt |
4238251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13342338 - 13342259
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
13342338 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt |
13342259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23908482 - 23908561
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
23908482 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
23908561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25067677 - 25067756
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
25067677 |
tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt |
25067756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 31582727 - 31582806
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||| ||||||| |||||||||||| |
|
|
T |
31582727 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatatgcaaaatgccccccaaacttaaaaatttatatt |
31582806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31586570 - 31586491
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
31586570 |
tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
31586491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 36027106 - 36027184
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36027106 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
36027184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39668924 - 39669002
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
39668924 |
tgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
39669002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40163171 - 40163250
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
40163171 |
tgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
40163250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42390118 - 42390040
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||||| |||||||||||| |
|
|
T |
42390118 |
tgaacatgacgttttgcaaatattcccctgaagttttgcacttatgtgtaaaatgcccc-caaacttaaaaatttatatt |
42390040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 47799127 - 47799206
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
47799127 |
tgaacatgacgttttgcaaatactcccctgaagttttgcgcttatgtgcaaaatgcccccaaaacttaaaaatttatatt |
47799206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 47799730 - 47799652
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
47799730 |
tgaacatgacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
47799652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 49255783 - 49255862
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
49255783 |
tgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
49255862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 49256392 - 49256313
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
49256392 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccccgaaacttaaaaatttatatt |
49256313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 52171064 - 52171143
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
52171064 |
tgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
52171143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 55153486 - 55153565
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
55153486 |
tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
55153565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 55154095 - 55154016
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
55154095 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaatttatatt |
55154016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 18073890 - 18073812
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||| |||||||| |||||||||||| ||||||| |||||||||||| |
|
|
T |
18073890 |
tgaacatgacgttttgcaaataccccctaaagtttttcacttatgcgcaaaatgcccctcaaacttaaaaatttatatt |
18073812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 33305909 - 33305831
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| ||||| | ||||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
33305909 |
tgaacatgacgttttgtaaataccacctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
33305831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 52394554 - 52394636
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
T |
52394554 |
tgaacatgacgttttgcaaatacccctatgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatattttt |
52394636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 54627160 - 54627238
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
T |
54627160 |
aacataacgttttgcaaataacccctgaagtttcgcacttatgtgcaaaatgcccccaaaacttggaaatttatatttt |
54627238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 102 - 178
Target Start/End: Complemental strand, 7580532 - 7580456
Alignment:
Q |
102 |
atgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||| ||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
7580532 |
atgacgttttgtaaatacccctctgaagttttgcacttatgtgcaaaatgcccc-caaacttgaaaatttatattttt |
7580456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 103 - 175
Target Start/End: Original strand, 10656218 - 10656291
Alignment:
Q |
103 |
tgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
10656218 |
tgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
10656291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 10657117 - 10657038
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
10657117 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
10657038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 29006856 - 29006776
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
29006856 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgctccccaaacttaaaaatttatatt |
29006776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38599000 - 38599080
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
38599000 |
tgaacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
38599080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 40065621 - 40065701
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
40065621 |
aacataacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatttt |
40065701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 53178376 - 53178453
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| || ||||||||| |
|
|
T |
53178376 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaatatttatatt |
53178453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 14509309 - 14509385
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
14509309 |
aacatgacgttttgcaaatatccccctgaagttttacacttatgtgcaaaatgccctccgaacttgaaaatttatat |
14509385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 24782223 - 24782299
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| ||||||| |||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
T |
24782223 |
aacataacgttttccaaataccccctgaagttttgcacttatgtgcaaaatgtcccttaaacttgaaaatttatatt |
24782299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 26839291 - 26839366
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
26839291 |
aacatgacgttttgcaaatactcccctgaagttttacacttatgtgcaaaatgcccc-cgaacttgaaaatttatat |
26839366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 172
Target Start/End: Original strand, 42855876 - 42855952
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| ||||||| ||||||||| |
|
|
T |
42855876 |
tgaacatgacgttttgcaaatacccccctgaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttat |
42855952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 54492852 - 54492932
Alignment:
Q |
99 |
aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
54492852 |
aacatgacgttttgcaaatatttccctgaagttttgcacttatgtgcaaaatgccgcctgaacttgaaaatttatattttt |
54492932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 103 - 170
Target Start/End: Complemental strand, 1033787 - 1033720
Alignment:
Q |
103 |
tgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||| |||||| |
|
|
T |
1033787 |
tgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccgaacttgcaaattt |
1033720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 10120036 - 10120114
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
10120036 |
tgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
10120114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23781138 - 23781217
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| ||||| || ||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
23781138 |
tgaacataacgttttgcaaatacccccttaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
23781217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24814208 - 24814286
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
24814208 |
tgaatatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
24814286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 96 - 179
Target Start/End: Complemental strand, 26839486 - 26839403
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttg |
179 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| | |||||||| ||| |||| || ||||||||||| |||| |
|
|
T |
26839486 |
atgaacatgaagttttgcaaatatcccctgaagttttgcacttacgagcaaaatgtcccccaaatttaaaaatttatatgtttg |
26839403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36791715 - 36791636
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| ||||| |||| |||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36791715 |
tgaacatgacgttttgtaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
36791636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42389511 - 42389590
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctg-aagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
42389511 |
tgaacatgacgttttgcaaataccccctttaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt |
42389590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 46976820 - 46976741
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||| |||||| |||||||||||| |
|
|
T |
46976820 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatttgcaaaatgccccctaaacttaaaaatttatatt |
46976741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 49527924 - 49527845
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| || ||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
49527924 |
tgaacatgacgttttgcaaatacccccttaaagttttgcacttatgtgcaaaatgtcccccaaacttcaaaatttatatt |
49527845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 55482320 - 55482242
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
T |
55482320 |
aacatgacgttt-gcaaatatcccctgaagttttgcacttatgtgcaaaatgtccactgaacttgaaaatttatattttt |
55482242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 4584135 - 4584213
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||| |||||||||||||||||||||||||| |||| ||||||| ||||||||||| |
|
|
T |
4584135 |
tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaattccccccaaacttaaaaatttatat |
4584213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 5153119 - 5153041
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||| |||||| || ||||||| |||||||||||| |
|
|
T |
5153119 |
tgaacatgacgttttgcaaataccccccgaagttttgcacttatgtgaaaaatgttccccaaacttaaaaatttatatt |
5153041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 100 - 175
Target Start/End: Original strand, 6071110 - 6071187
Alignment:
Q |
100 |
acatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6071110 |
acatgatgttttgcaaataccccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
6071187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 19238346 - 19238424
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| ||| ||||||||||||||||||| ||||||||||| | ||||| |||||||||||| |
|
|
T |
19238346 |
tgaacatgacattttgcaaataccccttgaagttttgcacttatgttcaaaatgcccccccaacttaaaaatttatatt |
19238424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 19961647 - 19961724
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| | | ||||||||||||||||||||||||||||||||| ||||| | |||||||||||| |
|
|
T |
19961647 |
tgaacatgacgttttgcaaacacctcctgaagttttgcacttatgtgcaaaatgcccc-caaacataaaaatttatatt |
19961724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 20496046 - 20495968
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
20496046 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaactt--aaatttatatt |
20495968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 31584819 - 31584900
Alignment:
Q |
99 |
aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
T |
31584819 |
aacatgacgttttgcaaatacctcccctgaaattttgcacttatgtgcaaaatgccccctgagcttgaaaatttatattttt |
31584900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 170
Target Start/End: Original strand, 34503538 - 34503612
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||| | ||||||||||||| |
|
|
T |
34503538 |
tgaacatgacgttttgcaaataccctcctgaagttttgcacttatatgcaaaatgccccccgaacttgaaaattt |
34503612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 35154633 - 35154555
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| ||| |||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
35154633 |
tgaacataacgttttgcaaataccccatgaagttttgcacttatgtgcaaaataccctccaaacttaaaaatttatatt |
35154555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 172
Target Start/End: Complemental strand, 38599610 - 38599534
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
T |
38599610 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttat |
38599534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 23909092 - 23909012
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||| || |||| |||||||||||| |
|
|
T |
23909092 |
tgaacatgacgtttggcaaatatcccccctgaagttttgcatttatgtgcaaaatgccccccatacttaaaaatttatatt |
23909012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24086226 - 24086306
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| ||| |||||||| |
|
|
T |
24086226 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaattttatatt |
24086306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31583337 - 31583257
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||| ||||||||| ||||||||||| ||||||| |||||||||||| |
|
|
T |
31583337 |
tgaacatgacgttttgcaaataccccccctgaagttttacacttatgtacaaaatgccccccaaacttaaaaatttatatt |
31583257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43727157 - 43727237
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| | | ||||||| |||||||||||| |
|
|
T |
43727157 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtctcccaaacttaaaaatttatatt |
43727237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 52961049 - 52961125
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| |||||||||| |
|
|
T |
52961049 |
tgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatacccc-caaacttacaaatttatat |
52961125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 53628193 - 53628113
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||| ||||||| |||||||||||| |
|
|
T |
53628193 |
tgaacatgacgttttgcaaatacaccccatgaagttttgcacttatgttcaaaatgccccccaaacttaaaaatttatatt |
53628113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 103 - 174
Target Start/End: Original strand, 8014742 - 8014814
Alignment:
Q |
103 |
tgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||| |||| |||||||||||||| |||||||||||||||| ||||||| ||||||||||| |
|
|
T |
8014742 |
tgacgttttgcaaatacccccctgaagttttgcactgatgtgcaaaatgccccccaaacttaaaaatttatat |
8014814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 35234976 - 35235052
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||| ||||||||||||||||| |
|
|
T |
35234976 |
aacatgacgttttgcaaatactcccctgaagttttgtacttatgtacaaaatgccccctgaacttgaaaatttatat |
35235052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13737088 - 13737167
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| ||||| ||||||||||||||| ||||||||||||| ||||||| |||||||||||| |
|
|
T |
13737088 |
tgaacatcacgttttgcaaatacacccctaaagttttgcacttatttgcaaaatgccccccaaacttaaaaatttatatt |
13737167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 20186535 - 20186613
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| || | ||||||| |
|
|
T |
20186535 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaacaattatatt |
20186613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21628007 - 21627928
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||| | |||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
21628007 |
tgaacataacgttttgcaaacaaccccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
21627928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 33305287 - 33305365
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
33305287 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcttc-caaacttaaaaatttatatt |
33305365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 34921424 - 34921475
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
34921424 |
aacatgacgttttgcaaatatcccttgaagttttgcacttatgtgcaaaatg |
34921475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 35235894 - 35235815
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| || |||||||||||||||||||| | |||||||||| ||||||||||||||||||||| |
|
|
T |
35235894 |
aacataacgttttgcaaataccctcctgaagttttgcacttatgcgaaaaatgccccctaaacttgaaaatttatatttt |
35235815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36259504 - 36259583
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| || ||||||||| |
|
|
T |
36259504 |
tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaagatttatatt |
36259583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 40514901 - 40514823
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| | ||||| |||||||||||| |
|
|
T |
40514901 |
tgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-cgaacttaaaaatttatatt |
40514823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 45258674 - 45258595
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||| | ||||||||||||||| | ||||| |||||||||||| |
|
|
T |
45258674 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacatgtgtgcaaaatgccccccgaacttaaaaatttatatt |
45258595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 19239906 - 19239828
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||| || | | || || |||||||||||| |
|
|
T |
19239906 |
tgaacatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatacctcccgaatttaaaaatttatatt |
19239828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24376853 - 24376775
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| |||||||||||| | |||||||||||| |||||||||||||||||| |||||| |||||||||||| |
|
|
T |
24376853 |
tgaacatgacattttgcaaatatttcatgaagttttgcatttatgtgcaaaatgccccccaaactcaaaaatttatatt |
24376775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 35234766 - 35234686
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
35234766 |
aacatgacgttttgcaaataccccctctgaagttttgcaattatgtgcaaaatgcccc-taaacttaaaaatttatattttt |
35234686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 38667271 - 38667329
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
38667271 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
38667329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 40791484 - 40791563
Alignment:
Q |
99 |
aacatgacgttttgcaaata----tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
40791484 |
aacatgacgttttgcaaataccccccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatat |
40791563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42248072 - 42248149
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||| |||| |||||||||||||||| |||| | ||||||||||| |||||| |
|
|
T |
42248072 |
tgaacatgacgttttgcaaataccccctgaaattttacacttatgtgcaaaatacccc-cgaacttgaaaatctatatt |
42248149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 42856753 - 42856676
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| |||||| ||||||||||| |
|
|
T |
42856753 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtccccaaaacttaaaaatttatat |
42856676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 9718654 - 9718578
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
9718654 |
aacatgacgttttacaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaa-tttaaaatttatatt |
9718578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 11653774 - 11653717
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||| |||| |
|
|
T |
11653774 |
tgaacatgacgttttgcaaataccctctgaagttttgcacttatgtgcaaaatacccc |
11653717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 98 - 162
Target Start/End: Original strand, 29006659 - 29006724
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaactt |
162 |
Q |
|
|
||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
29006659 |
gaacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccccccaaactt |
29006724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 34941655 - 34941575
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||| || ||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
34941655 |
tgaacatgacgttttgcaaatactccccctgaagtcttacacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
34941575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 53627316 - 53627392
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||| ||||| | |||||||| |||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
53627316 |
aacatgacgttttgcaaatgtccccctaaagttttgaacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
53627392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 168
Target Start/End: Original strand, 987265 - 987337
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaat |
168 |
Q |
|
|
||||||||| |||||||||||| ||||| |||||||||||||||| ||||||||||||| |||||| |||||| |
|
|
T |
987265 |
tgaacatgatgttttgcaaatacccccttgaagttttgcacttatatgcaaaatgccccccaaactggaaaat |
987337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 20819355 - 20819431
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||| ||||| ||||||||||| |
|
|
T |
20819355 |
aacatgacgttttgcaaatacccccttgaagttttgtacttatgtgcaaaatgccccctgaacttaaaaatttatat |
20819431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 29589024 - 29588945
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| | | |||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
29589024 |
aacatgacgttttgcaaatacttctctgaagttttgcacttatgtgcaaaatg-tccgtgaacttgaaaatttatattttt |
29588945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 32751738 - 32751662
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||| | || |||||||||||||| |
|
|
T |
32751738 |
aacatgacgttttgcaaatactcccctgaagttttgtacttatgtgcaaaatgcctcctgaatttgaaaatttatat |
32751662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 40066541 - 40066465
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||||||||| |||| |||||||||| |||||||| ||||||||||| |||||||||||||||||| |
|
|
T |
40066541 |
aacatgacattttgcaaatacccccctgaagttttgtacttatgttcaaaatgccccctaaacttgaaaatttatat |
40066465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 44405335 - 44405260
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||| ||||| |||||||||||| |
|
|
T |
44405335 |
aacatgacgttttgcaaata-cccctaaagttttgcacttatgtgcaaaatgtcccctgaacttaaaaatttatatt |
44405260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 54603177 - 54603101
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||||||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
54603177 |
aacatgacattttgcaaatatcttcctgaagttttgtacttatgtgcaaaatgccccatgaacttgaaaatttatat |
54603101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 55481472 - 55481551
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||| ||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
T |
55481472 |
aacatgacattttgcaaatacccccactgaagttttgcacttatgtgcaaaatgtcccctgaacttgaaaatttatattt |
55481551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 113 - 172
Target Start/End: Original strand, 1586977 - 1587036
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
1586977 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttat |
1587036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 2445198 - 2445123
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| || || |||||||||||||||||||||||||| | | ||||||||||||||||| |
|
|
T |
2445198 |
aacatgaagttttgcaaatacccactaaagttttgcacttatgtgcaaaatgcttccctaacttgaaaatttatat |
2445123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6071731 - 6071650
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
6071731 |
tgaacatgacattttgcaaatacccccccctgaagttttgcacttatgtgcaaaatgccctcaaaacttaaaaatttatatt |
6071650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 20189508 - 20189429
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| |||| |||||| |||| ||||||||||||||||||||||||||| ||| ||||| | |||||||||||| |
|
|
T |
20189508 |
tgaacatgacattttacaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacataaaaatttatatt |
20189429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38771764 - 38771685
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| ||| |||||||||||||||||||||| || |||||| |||||||||||| |
|
|
T |
38771764 |
tgaacatgacgttttgcaaatacccccttgaatttttgcacttatgtgcaaaatgttcccaaaacttaaaaatttatatt |
38771685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40782787 - 40782865
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| || |||||||||| |||||||||||||||||| | ||||| |||||||||||| |
|
|
T |
40782787 |
tgaacatgacgttttgcaaatacccctctaaagttttgcatttatgtgcaaaatgcccc-cgaacttaaaaatttatatt |
40782865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 41222638 - 41222559
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||| | || ||||||||||||||||||||||||||||| ||||||| ||||| | ||||||| |
|
|
T |
41222638 |
aacatgacattttgcaaatacctccctaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatatctattttt |
41222559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 42803137 - 42803059
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgc-aaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| ||| ||||||||||||||| |||||| |||||||||| |||||||||||||||||| |
|
|
T |
42803137 |
tgaacatgacgttttgcaaataccccgctgaagttttgcactgatgtgcaaaaatgcccc-aaaacttgaaaatttatat |
42803059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 45712546 - 45712597
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
45712546 |
aacatgatgttttgcaaataccccctgaagttttgcacttatgtgcaaaatg |
45712597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 52961628 - 52961574
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
52961628 |
cccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
52961574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 54801224 - 54801149
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| | |||||||||||||||||||||||||||||| | | |||||||||| |||||| |
|
|
T |
54801224 |
aacatcacgttttgcaaatactctctgaagttttgcacttatgtgcaaaatgccacccgaacttgaaaaattatat |
54801149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 3021220 - 3021278
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
3021220 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt |
3021278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 3937725 - 3937783
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
T |
3937725 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaaattatattttt |
3937783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 4070458 - 4070400
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
T |
4070458 |
cccctgaaattttgcacttatgtgcaaaataccccctaaacttgaaaatttatattttt |
4070400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 7579943 - 7580024
Alignment:
Q |
99 |
aacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||| || |||| || ||||||||| ||||| |
|
|
T |
7579943 |
aacataacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgctccccaaaattaaaaatttatcttttt |
7580024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 14899392 - 14899338
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
14899392 |
tgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
14899338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 102 - 175
Target Start/End: Original strand, 21627403 - 21627477
Alignment:
Q |
102 |
atgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| ||||||||||| |||| |||||||||||||||||||| |||||| ||| ||||||| |||||||||||| |
|
|
T |
21627403 |
atgacattttgcaaatacccccctgaagttttgcacttatgtgaaaaatgtcccccaaacttaaaaatttatatt |
21627477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 25068297 - 25068239
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
T |
25068297 |
tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc |
25068239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 169
Target Start/End: Complemental strand, 31585270 - 31585201
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt |
169 |
Q |
|
|
||||||||||||||||||||||||| | |||||||| |||||||||||||||||| ||||||||||||| |
|
|
T |
31585270 |
aacatgacgttttgcaaatatcccccca-gttttgcagttatgtgcaaaatgccccctaaacttgaaaatt |
31585201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 36951844 - 36951786
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
36951844 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt |
36951786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 40009443 - 40009524
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||| |||||||||||| |||||| ||||||||| | ||||||||||||||||||||| |
|
|
T |
40009443 |
aacatgacattttgcaaatatcccccctgaagttttgcatttatgtacaaaatgcctcatgaacttgaaaatttatattttt |
40009524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 49316193 - 49316247
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
49316193 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat |
49316247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 150
Target Start/End: Complemental strand, 52395116 - 52395062
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
T |
52395116 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg |
52395062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 10473756 - 10473691
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| ||| |||| |||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
10473756 |
caaataccccttgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt |
10473691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 33982109 - 33982044
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
33982109 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaatttagattttt |
33982044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 37703723 - 37703799
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| ||||||||||| |||| ||||||||||||||||||||| ||||||||| |||| || |||||||||||| |
|
|
T |
37703723 |
aacatgacattttgcaaatacccccctgaagttttgcacttatgtgc-aaatgccccccaaatttaaaaatttatatt |
37703799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 43354505 - 43354440
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
43354505 |
caaatatcgcctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
43354440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 45257965 - 45258044
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||||||||||||| ||||||||||||||||| ||| ||||||| ||||| |||||| |
|
|
T |
45257965 |
tgaacatgatgttttgcaaatacctcccctgaagttttacacttatgtgcaaaatgtccc-caaacttaaaaatctatatt |
45258044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 1092147 - 1092223
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||| ||||||||||||||| |||| |||||||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
1092147 |
aacaagacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgtcccctgaacttgaaaatttatat |
1092223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 172
Target Start/End: Complemental strand, 4490354 - 4490279
Alignment:
Q |
99 |
aacatgacgttttgcaaatatc--ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
|||||||| ||||||||||||| ||||||||||| |||||||||||||||||| | ||||||||||||||||| |
|
|
T |
4490354 |
aacatgacattttgcaaatatctcccctgaagtttagcacttatgtgcaaaatgttctccaaacttgaaaatttat |
4490279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 24783133 - 24783057
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||| |||| ||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
24783133 |
aacatgacgttttgcaaattcccccccgaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttatat |
24783057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 32750817 - 32750893
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||| |||||||||||||||||| | ||||||||| ||||||| |
|
|
T |
32750817 |
aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgcctcatgaacttgaaattttatat |
32750893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 107 - 178
Target Start/End: Original strand, 37332741 - 37332813
Alignment:
Q |
107 |
gttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| ||||||||||||| | ||||||||||||||||||||| |
|
|
T |
37332741 |
gttttgcaaatacccccttgaagttttgcacttgtgtgcaaaatgccttccgaacttgaaaatttatattttt |
37332813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 39285073 - 39285125
Alignment:
Q |
122 |
cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
39285073 |
cctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat |
39285125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 40792353 - 40792273
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||| |||| |||||||||||| |||| ||||||||||||| ||||||||||||| || ||||| |
|
|
T |
40792353 |
aacatgacattttgcaaatacccccctgaagttttgcagttatatgcaaaatgccccctaaacttgaaaattcattttttt |
40792273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 46651129 - 46651077
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
T |
46651129 |
aacatgacgttttgcaaatatccccctgaagttttgtacttatgtgcaaaatg |
46651077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 9103383 - 9103434
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
|||||||||||||||||||| ||||||| ||||| ||||||||||||||||| |
|
|
T |
9103383 |
aacatgacgttttgcaaatagcccctgaggttttacacttatgtgcaaaatg |
9103434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 107 - 178
Target Start/End: Complemental strand, 34922103 - 34922033
Alignment:
Q |
107 |
gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| || ||||||||||||||||||||||||||||| || ||||||||||||||| ||||| |
|
|
T |
34922103 |
gttttgcaaata-cctctgaagttttgcacttatgtgcaaaatgctcccataacttgaaaatttatgttttt |
34922033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 35233874 - 35233949
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||| ||||||||||||| ||| || | |||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
35233874 |
aacatggcgttttgcaaataccccatggaattttgcacttatgtgcaaaatgtcccttgaacttgaaaatttatat |
35233949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 45148944 - 45148999
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
45148944 |
ctgaaattttgcacttatgtgcaaaatgccctctaaacttgaaaatttatattttt |
45148999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 50314407 - 50314352
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||| |||||||||||||| |||||||| ||||||||||||||||||||| |||| |
|
|
T |
50314407 |
aacatcacgttttgcaaataccccctgaaattttgcacttatgtgcaaaatacccc |
50314352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 100 - 178
Target Start/End: Complemental strand, 54493616 - 54493537
Alignment:
Q |
100 |
acatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||| ||||| | |||| |||||||||||||||||||||||||| || ||||| ||||||||||||||| |
|
|
T |
54493616 |
acatgacgttttgtaaatacctccctcaagttttgcacttatgtgcaaaatgctccctcaacttaaaaatttatattttt |
54493537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 1587811 - 1587753
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
1587811 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
1587753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 22847846 - 22847792
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| |||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
22847846 |
tgaaattttacacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
22847792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 38667767 - 38667709
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
38667767 |
cccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaatttagattttt |
38667709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38770432 - 38770508
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| |||||||||||||||| ||||||||||||||||||||| | |||||||| || |||||| |||||||||||| |
|
|
T |
38770432 |
tgaacctgacgttttgcaaata-cccctgaagttttgcacttatatacaaaatgctcc-taaacttaaaaatttatatt |
38770508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 40278263 - 40278317
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| || |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
40278263 |
cccctaaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat |
40278317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 43914651 - 43914601
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
43914651 |
tgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttatat |
43914601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 46975973 - 46976049
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| ||| ||||||||||||||||||||||||||| ||| | ||||| |||||| ||||| |
|
|
T |
46975973 |
tgaacatgacgtttttcaaata-cccatgaagttttgcacttatgtgcaaaatgtccc-ccaacttaaaaattaatatt |
46976049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 49316738 - 49316680
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
49316738 |
cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt |
49316680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 55117176 - 55117099
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| | |||||| |||| ||||||| |||||||| |||| ||||||| |||||||||||| |
|
|
T |
55117176 |
tgaacatgacgttttacaaatacctcctgaatttttacacttatttgcaaaatacccc-caaacttaaaaatttatatt |
55117099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 126 - 175
Target Start/End: Complemental strand, 987894 - 987845
Alignment:
Q |
126 |
aagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
987894 |
aagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttatatt |
987845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 13268585 - 13268650
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| ||| ||| |||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
13268585 |
caaataccccctgaaatttggcatttatgtgcaaaatgccccctaaatttgaaaatttatattttt |
13268650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 97 - 153
Target Start/End: Complemental strand, 39172476 - 39172419
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccc |
153 |
Q |
|
|
||||||||| |||||||||||| |||| |||| ||||||||||||||||||||||||| |
|
|
T |
39172476 |
tgaacatgatgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccc |
39172419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 9667281 - 9667205
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||| |||| | |||||||||||||||||| | ||||||||||||| | |||||||||||||||| |
|
|
T |
9667281 |
aacatgacgttttgttaatacttccctgaagttttgcacttctatgcaaaatgccccccggacttgaaaatttatat |
9667205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 174
Target Start/End: Original strand, 29587242 - 29587309
Alignment:
Q |
107 |
gttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| ||| ||||||||||||||||||||| |||||||||| || | ||||||||||||||||| |
|
|
T |
29587242 |
gttttgcaactattcccctgaagttttgcacttatttgcaaaatgctcc-cgaacttgaaaatttatat |
29587309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 151
Target Start/End: Original strand, 30835109 - 30835161
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc |
151 |
Q |
|
|
||||||| |||||||||||| |||||||||||||||| |||||||||||||| |
|
|
T |
30835109 |
aacatgatgttttgcaaatacgccctgaagttttgcacatatgtgcaaaatgc |
30835161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 40010128 - 40010076
Alignment:
Q |
103 |
tgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
T |
40010128 |
tgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatacccc |
40010076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 40279106 - 40279050
Alignment:
Q |
122 |
cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
40279106 |
cctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
40279050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 42802131 - 42802206
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| ||||||| |||||| || || ||||||||||||||||||||||||| ||| | ||||| |||||||||||| |
|
|
T |
42802131 |
aacataacgttttacaaataccctctaaagttttgcacttatgtgcaaaatgtccc-cgaacttaaaaatttatatt |
42802206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 98 - 178
Target Start/End: Complemental strand, 49223652 - 49223572
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||| |||| |||| |||||||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
T |
49223652 |
gaacatgacgttttgcaaatacccccctaaaagtgttgcacttatatgcaaaatgcaccg--aacttgaaaatttatattttt |
49223572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 143
Target Start/End: Original strand, 53757852 - 53757895
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtg |
143 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
53757852 |
aacatgacgttttgcaaatatcccc-gaagttttgcacttatgtg |
53757895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 54800199 - 54800279
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaac-ttgaaaatttatattttt |
178 |
Q |
|
|
||||| || |||| |||||| |||||||| |||| || |||||||||||||||||| | ||| |||||||||||||||||| |
|
|
T |
54800199 |
aacatcacattttacaaataccccctgaaattttacatttatgtgcaaaatgccccccgaactttgaaaatttatattttt |
54800279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 115 - 174
Target Start/End: Original strand, 17753960 - 17754019
Alignment:
Q |
115 |
aatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||| |||||||| ||||||| |||||||||||||||||| ||| |||||||||||||| |
|
|
T |
17753960 |
aataccccctgaaattttgcatttatgtgcaaaatgccccctaaatttgaaaatttatat |
17754019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 115 - 174
Target Start/End: Original strand, 19055280 - 19055339
Alignment:
Q |
115 |
aatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||| |||||||| ||||||| |||||||||||||||||| ||| |||||||||||||| |
|
|
T |
19055280 |
aataccccctgaaattttgcatttatgtgcaaaatgccccctaaatttgaaaatttatat |
19055339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 171
Target Start/End: Original strand, 21414445 - 21414496
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |
|
|
T |
21414445 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
21414496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 26035022 - 26034964
Alignment:
Q |
119 |
tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||||||||| || |||||||||||||||||| ||||||| ||||||||||||||| |
|
|
T |
26035022 |
tcccatgaagttttacatttatgtgcaaaatgcccc-caaacttaaaaatttatattttt |
26034964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 33129274 - 33129200
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| ||||||||||||||| |||||| ||||||| ||| |||||| ||||||||||| |
|
|
T |
33129274 |
aacataacgttttgcaaatactccctgaagttttgca-ttatgtacaaaatggccccaaaacttaaaaatttatat |
33129200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 39285329 - 39285274
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
39285329 |
ctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
39285274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 198 - 293
Target Start/End: Complemental strand, 40138685 - 40138596
Alignment:
Q |
198 |
acaggtgaggaagttggaactgctgatttcaatttcaattctagtatttgtaatggcggcatgtttctttggtgaattgagctatggaaaaccccc |
293 |
Q |
|
|
||||||||||||||||||||| ||||| || |||| ||||||||||||||||| | ||||||||||| |||| ||||||||| ||| ||||| |
|
|
T |
40138685 |
acaggtgaggaagttggaactactgat---aa---caatcctagtatttgtaatggctggatgtttctttgctgaaatgagctatgtaaatccccc |
40138596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 54628076 - 54627994
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgc-cccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||| |||||| ||||| ||||||||| ||||||||||||||||| ||| ||||||| |||||| ||||||| |
|
|
T |
54628076 |
aacatgacgttttacaaataccccctctgaagttttgtacttatgtgcaaaatgctccctgaaacttggaaatttttattttt |
54627994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 3022168 - 3022110
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||| ||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
3022168 |
cccctgaaattttacacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
3022110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 4069940 - 4069998
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
4069940 |
cccccgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt |
4069998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 13269133 - 13269079
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
13269133 |
tgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
13269079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 14898882 - 14898940
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||| ||||||||||||| |||||| |||||||| |||||| |
|
|
T |
14898882 |
cccctgaaattttgcacttatatgcaaaatgccccctaaacttaaaaatttagattttt |
14898940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 22847030 - 22847087
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
22847030 |
cccctgaaattttgcacttatgtgcaaaatgcccc-taaacttaaaaatttagattttt |
22847087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 27656224 - 27656166
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||| || |||||||| |||||| |
|
|
T |
27656224 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaatttaaaaatttacattttt |
27656166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 29492161 - 29492214
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||||||||||||||||||||||| || | ||||||||||||||||||||| |
|
|
T |
29492161 |
tgaaattttgcacttatgtgcaaaatgctcc-ctaacttgaaaatttatattttt |
29492214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 33128546 - 33128623
Alignment:
Q |
99 |
aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||| |||||| || |||||| ||| |||||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
33128546 |
aacatgacgttttccaaatacctctcctgaaatttcgcacttatgtgcaaaatgtcccttgaacttgaaaatttatat |
33128623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 33981551 - 33981605
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||| |||||||||||| ||||| |
|
|
T |
33981551 |
cccctgaaattttgcacttatgtgcaaaatgtcccctaaacttgaaaatatatat |
33981605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 152
Target Start/End: Complemental strand, 37117127 - 37117073
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcc |
152 |
Q |
|
|
||||| ||||||||| ||||||||| | ||||||||||||||||||||||||||| |
|
|
T |
37117127 |
aacataacgttttgctaatatccccctaaagttttgcacttatgtgcaaaatgcc |
37117073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40512471 - 40512548
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| ||||||||| |||||| |||| |||||||||||||||||| ||||||||| ||||||| |||| ||||||| |
|
|
T |
40512471 |
tgaacttgacgtttttcaaataccccc-gaagttttgcacttatgtacaaaatgcctttcaaacttcaaaaattatatt |
40512548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 45969478 - 45969536
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||| |||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
45969478 |
cccctgaaattttgcactcatgtgcaaaatgccccctaaacttaaaaatttagattttt |
45969536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 99 - 167
Target Start/End: Original strand, 9665627 - 9665696
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa |
167 |
Q |
|
|
||||||| |||||||||||| || ||||||||||||||||||||||||||| || | | |||||||||| |
|
|
T |
9665627 |
aacatgatgttttgcaaatacaccgctgaagttttgcacttatgtgcaaaatacctcccgaacttgaaaa |
9665696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 33777658 - 33777722
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||||| ||||||||| |||||| |||||||| |||||| |
|
|
T |
33777658 |
caaataccccctgaaattttgcacttatgtgc-aaatgccccctaaacttaaaaatttagattttt |
33777722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 129 - 178
Target Start/End: Complemental strand, 45149750 - 45149701
Alignment:
Q |
129 |
ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
45149750 |
ttttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
45149701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 8015592 - 8015516
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||| ||||||||||| | ||||| || ||||||||||||||| |||| |||||| ||||||||||||||||| |
|
|
T |
8015592 |
aacatggcgttttgcaaacacccccttaaagttttgcacttatgtacaaattgccccttgaacttgaaaatttatat |
8015516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 43353690 - 43353750
Alignment:
Q |
119 |
tcccctgaagttttgcacttatgtgcaaaatgccccgcaaa-cttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| |||||||||||||||||||||||||| ||| || ||||||||||||||| |
|
|
T |
43353690 |
tcccctgaaattttgcacttatgtgcaaaatgccccctaaattttaaaaatttatattttt |
43353750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 98 - 150
Target Start/End: Original strand, 49223349 - 49223401
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
||||||||||||||| ||||| || | ||||||||||||||||||||||||| |
|
|
T |
49223349 |
gaacatgacgttttgaaaataccctataaagttttgcacttatgtgcaaaatg |
49223401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 124 - 167
Target Start/End: Original strand, 21576698 - 21576741
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa |
167 |
Q |
|
|
|||| |||||||||||||||||||||||||| ||||||||||| |
|
|
T |
21576698 |
tgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaa |
21576741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 107 - 178
Target Start/End: Original strand, 35547103 - 35547174
Alignment:
Q |
107 |
gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||| | |||| ||||||||||| || ||||||||| |||| | || |||||||||||||||||| |
|
|
T |
35547103 |
gttttgcaaacacccccagaagttttgcatctaagtgcaaaataccccccgaatttgaaaatttatattttt |
35547174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 33237732 - 33237674
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||| |||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
33237732 |
cccctgaaattttacacttatgtgcaaaatgccctctaaacttaaaaatttagattttt |
33237674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 37090434 - 37090376
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| |||||| ||| |||| |||||| |
|
|
T |
37090434 |
cccctgaaattttgcacttatgtgcaaaatgccctctaaacttaaaattttagattttt |
37090376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 43913831 - 43913889
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||| ||||||||||| ||| || |||||||| |||||| |
|
|
T |
43913831 |
cccctgaaattttgcacttatgtacaaaatgccccttaaatttaaaaatttagattttt |
43913889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 17754799 - 17754734
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||| ||| |||| ||||||||||||||||||||| ||| || |||||||| |||||| |
|
|
T |
17754799 |
caaataacccccgaattttttcacttatgtgcaaaatgccccctaaatttaaaaatttagattttt |
17754734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 19056119 - 19056054
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||| ||| |||| ||||||||||||||||||||| ||| || |||||||| |||||| |
|
|
T |
19056119 |
caaataacccccgaattttttcacttatgtgcaaaatgccccctaaatttaaaaatttagattttt |
19056054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 153
Target Start/End: Complemental strand, 21414703 - 21414670
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccc |
153 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| |
|
|
T |
21414703 |
cccctgaaattttgcacttatgtgcaaaatgccc |
21414670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 148
Target Start/End: Complemental strand, 25360291 - 25360242
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaa |
148 |
Q |
|
|
|||||||| ||||||||||| ||| | |||| |||||||||||||||||| |
|
|
T |
25360291 |
aacatgactttttgcaaataccccttaaagtattgcacttatgtgcaaaa |
25360242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 139
Target Start/End: Original strand, 36791173 - 36791217
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata--tcccctgaagttttgcactta |
139 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
36791173 |
tgaacatgacgttttgcaaataccccccctgaagttttgcactta |
36791217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 164
Target Start/End: Original strand, 37089623 - 37089664
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttga |
164 |
Q |
|
|
||||| |||||||||||||||||||||||||| |||||||| |
|
|
T |
37089623 |
ctgaaattttgcacttatgtgcaaaatgccccttaaacttga |
37089664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 53082076 - 53082121
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt |
169 |
Q |
|
|
|||| |||||||||||||||||||||||||| |||||| |||||| |
|
|
T |
53082076 |
tgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatt |
53082121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 17571759 - 17571817
Alignment:
Q |
99 |
aacatgacgttttgcaaat---atcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||| |||| |||||||||||||||||||||||||| |||| |
|
|
T |
17571759 |
aacatgacgttttgcaaaatacatcctatgaagttttgcacttatgtgcaaaatacccc |
17571817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 20411178 - 20411102
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||| |||||| | | ||||| ||||| |||||||||||||||||||| || |||||||||||||| |
|
|
T |
20411178 |
aacatgacattttccaaatacctcactgaaattttgtacttatgtgcaaaatgccccctgaatttgaaaatttatat |
20411102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 124 - 175
Target Start/End: Original strand, 21197095 - 21197144
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| ||||||||||| || ||||||| |||||||||||| |
|
|
T |
21197095 |
tgaagttttgcactt--gtgcaaaatgcaccccaaacttaaaaatttatatt |
21197144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 142 - 178
Target Start/End: Original strand, 23336197 - 23336233
Alignment:
Q |
142 |
tgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||| |||||||||||||||||||||| |
|
|
T |
23336197 |
tgcaaaatgccccataaacttgaaaatttatattttt |
23336233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 41221820 - 41221896
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||||||||| |||| |||| ||||||| |||||||||| || |||| ||||| ||||||||||| |
|
|
T |
41221820 |
aacatgacattttgcaaatacccccctgaaattttgcatttatgtgcaagataccccctgaacttaaaaatttatat |
41221896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 120 - 164
Target Start/End: Complemental strand, 45970676 - 45970632
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga |
164 |
Q |
|
|
|||||||| ||||||||||||||||||||||| || |||||||| |
|
|
T |
45970676 |
cccctgaaattttgcacttatgtgcaaaatgcaccctaaacttga |
45970632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 114 - 154
Target Start/End: Complemental strand, 50314360 - 50314320
Alignment:
Q |
114 |
aaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||| |||||||| ||||||||||||||||||||| |||| |
|
|
T |
50314360 |
aaataccccctgaaattttgcacttatgtgcaaaattcccc |
50314320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 101; Significance: 9e-50; HSPs: 135)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 9e-50
Query Start/End: Original strand, 97 - 221
Target Start/End: Original strand, 3362824 - 3362948
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttgggatgtttgggcatata |
196 |
Q |
|
|
|||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
3362824 |
tgaacatgacgttttgcaaataccccttgaagttttgcacttatatgcaaaatgccccgcaaacttgaaaatttatatttttggtatgtttgggcatata |
3362923 |
T |
 |
Q |
197 |
cacaggtgaggaagttggaactgct |
221 |
Q |
|
|
|| ||||||| |||||||||||||| |
|
|
T |
3362924 |
cagaggtgagaaagttggaactgct |
3362948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 26368071 - 26367990
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
T |
26368071 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt |
26367990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1550115 - 1550193
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
1550115 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
1550193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25774932 - 25775010
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
25774932 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
25775010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 41799943 - 41799863
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
41799943 |
atgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
41799863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 40651494 - 40651415
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
40651494 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
40651415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 12178671 - 12178593
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
12178671 |
tgaacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
12178593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 16057406 - 16057483
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
16057406 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
16057483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 28243358 - 28243276
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
T |
28243358 |
tgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt |
28243276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 44258121 - 44258198
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
44258121 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
44258198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4356835 - 4356915
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
4356835 |
tgaacatgacgttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
4356915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 15830902 - 15830822
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
15830902 |
aacatgacgttttgcaaatatccccctgaagttttgtacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
15830822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 35059188 - 35059108
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
35059188 |
aacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttatattttt |
35059108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 122222 - 122143
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
122222 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
122143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 12178063 - 12178142
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
12178063 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
12178142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 19223607 - 19223528
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
19223607 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
19223528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 22064616 - 22064541
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
22064616 |
aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat |
22064541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 25775531 - 25775452
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
25775531 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
25775452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25991995 - 25992073
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
25991995 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
25992073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 37224590 - 37224669
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
37224590 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
37224669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38964864 - 38964785
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
38964864 |
tgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
38964785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 39939410 - 39939489
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
39939410 |
aacatgaagttttgcaaatatcccctgaagttttgcatttatgtgcaaaatgccccctaaacttaaaaatttatattttt |
39939489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40598553 - 40598632
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
40598553 |
tgaacatgacgttttgcaaatatcaccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
40598632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40650885 - 40650964
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
40650885 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
40650964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4357445 - 4357367
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
4357445 |
tgaacatgacgttttgcaaataccccctgaaattttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt |
4357367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 32892232 - 32892310
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||| |||||||| |
|
|
T |
32892232 |
tgaagatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaattttatatt |
32892310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32892839 - 32892761
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
32892839 |
tgaacatgaagttttgcaaataccccttgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt |
32892761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 39500984 - 39500906
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
39500984 |
tgaacatgaagttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
39500906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 3434574 - 3434654
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
3434574 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
3434654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 22487267 - 22487347
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
22487267 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
22487347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41799332 - 41799412
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
41799332 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
41799412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 121614 - 121692
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
121614 |
tgaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
121692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 1550694 - 1550616
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
1550694 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
1550616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 7532041 - 7532115
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
7532041 |
aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgcccc-cgaacttgaaaatttatat |
7532115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 9708004 - 9708083
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
9708004 |
aacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatttt |
9708083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 12138621 - 12138700
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||| |
|
|
T |
12138621 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaattttttattttt |
12138700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 17816189 - 17816114
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
17816189 |
aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccgaacttaaaaatttatat |
17816114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 22482048 - 22481969
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
22482048 |
tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
22481969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26367463 - 26367542
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
26367463 |
tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
26367542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 28242748 - 28242826
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
28242748 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
28242826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 33869760 - 33869839
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| | |||||||||||| |
|
|
T |
33869760 |
tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaattgaaaaatttatatt |
33869839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36566451 - 36566372
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
36566451 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
36566372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 2695825 - 2695745
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
2695825 |
tgaacatgacgtcttgcaaataccctccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
2695745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 5440230 - 5440307
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
5440230 |
aacatgacgttttgcgaatactcccttgaagttttgcacttatgtgcaaaatgcccctcaaactttaaaatttatatt |
5440307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8345896 - 8345976
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
8345896 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt |
8345976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 3074951 - 3074872
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
3074951 |
gaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
3074872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 7275590 - 7275514
Alignment:
Q |
99 |
aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||| |||||||| |||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
T |
7275590 |
aacatgacgttttacaaatatctccctaaagttttgcacttatgttcaaaatgccccccaaacttgaaaatttatat |
7275514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 21540439 - 21540519
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||||| |||| |||||||||||||| ||||||||||| | || |||||||||||||||||| |
|
|
T |
21540439 |
aacatgacgttttgcaaatatccccctgaatttttgcacttatgtacaaaatgccccccgaagttgaaaatttatattttt |
21540519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42793755 - 42793675
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
42793755 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttatatt |
42793675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 45630054 - 45630134
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
45630054 |
tgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttatatt |
45630134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 162
Target Start/End: Original strand, 3910330 - 3910393
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaactt |
162 |
Q |
|
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
3910330 |
aacataacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccacaaactt |
3910393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6166316 - 6166395
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||| |||||| |||||||||||| |
|
|
T |
6166316 |
tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatggccccaaaacttaaaaatttatatt |
6166395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8346500 - 8346421
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
8346500 |
tgaacatgacgttttgcaaatattctcctgaagttttgcacttatgtgcaaaatgcttcccaaacttaaaaatttatatt |
8346421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13700417 - 13700496
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| |||| || |||||||||||| |
|
|
T |
13700417 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaatttaaaaatttatatt |
13700496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 16058012 - 16057934
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
16058012 |
tgaacatgacgttt-gcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
16057934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 19222999 - 19223077
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
19222999 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgaccc-caaacttaaaaatttatatt |
19223077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 33008457 - 33008379
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| | |||||||||| ||||||| |
|
|
T |
33008457 |
tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatg-ccctcgaacttgaaaaattatatt |
33008379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 36207107 - 36207186
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||||| |||||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
T |
36207107 |
aacatgacgttttgcaaataccccctgatgttttgcacttatgtgtaaaatgtcccatgaacttgaaaatttatattttt |
36207186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 107 - 174
Target Start/End: Original strand, 38935863 - 38935930
Alignment:
Q |
107 |
gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||| ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
38935863 |
gtttagcaaataccccctgaagttttgcacttatgtgcaaaatgccccgtgaacttgaaaatttatat |
38935930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42793146 - 42793224
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||| ||||||| |
|
|
T |
42793146 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaacttatatt |
42793224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 108 - 174
Target Start/End: Original strand, 4646038 - 4646104
Alignment:
Q |
108 |
ttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
T |
4646038 |
ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccctaaacttgaaaatttatat |
4646104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 28638071 - 28637993
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| | ||| |||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
28638071 |
tgaacatgaagttttgcaaatacctccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
28637993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 44747951 - 44747873
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||| | ||||| |||||||||||| |
|
|
T |
44747951 |
tgaacatgacgttttggaaataccccctaaagttttgcacttatgtgcaaaatgcccatcgaacttaaaaatttatatt |
44747873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 3435138 - 3435081
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
T |
3435138 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatatgcaaaatgcccc |
3435081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 1091318 - 1091242
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| || ||||||||||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
1091318 |
aacataacgttttgcaaatacccacctgaagttttgcacttatgtgcaaaatgccccccgaactttaaaatttatat |
1091242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 3106284 - 3106364
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| |||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
3106284 |
aacatgatgttttgcaaatacccccaagaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatattttt |
3106364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 3107030 - 3106954
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
T |
3107030 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccatgaacttaaaaatttatat |
3106954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 4647012 - 4646932
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||| || |||||||||||||||||| |
|
|
T |
4647012 |
aacatgacgttttgcaaatatcttcctgaagttttgcacttatgtgcaaaatcccccctgaatttgaaaatttatattttt |
4646932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 5606926 - 5607006
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||| | | |||||||||||||||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
T |
5606926 |
aacatgacattttgcaaatacctcactgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatattttt |
5607006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 9708932 - 9708852
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||| |||||||||||||||||||| ||||| ||||||||||||||| |
|
|
T |
9708932 |
aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccccctgaactttaaaatttatattttt |
9708852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 14251994 - 14252074
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| | || |||||||||||||||||||||||||| |||| | ||||| ||||||||||||||| |
|
|
T |
14251994 |
aacatgacgttttgcaaatacctccatgaagttttgcacttatgtgcaaaataccccccgaacttaaaaatttatattttt |
14252074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 20207163 - 20207243
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| ||||||||||||||| | |||||||||||||||||| |||||||||| ||| ||||||| ||||||||||||||| |
|
|
T |
20207163 |
aacatcacgttttgcaaatattctcctgaagttttgcacttacgtgcaaaatgtccctcaaacttaaaaatttatattttt |
20207243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 22064036 - 22064115
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
T |
22064036 |
tgaacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatat |
22064115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6166924 - 6166846
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| | ||| ||| |||||||||||| |
|
|
T |
6166924 |
tgaacatgacgttttgcaaatactcccctgaagttttgcatttatgtgcaaaatgcctc-caagcttaaaaatttatatt |
6166846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7778482 - 7778403
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
7778482 |
tgaacatgacgttttgcaaatatccccctgaaattttgcacttatgtgcaaaatgccatccaaatttaaaaatttatatt |
7778403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 21545326 - 21545247
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| || ||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||| |
|
|
T |
21545326 |
aacataacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgcctcctgaacttgaaaatttatgttttt |
21545247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 37225192 - 37225111
Alignment:
Q |
98 |
gaacatgacgttttgcaaata---tcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||| |||| ||||||| |
|
|
T |
37225192 |
gaacatgacgttttgcaaatactttccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaacttatatt |
37225111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 3074380 - 3074438
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
T |
3074380 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc |
3074438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 7777595 - 7777673
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| | ||||||||||||| ||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
7777595 |
gaacatgacgttttgcaaatacctccctgaagttttgtacttatgtgcaaaatatcccccaaacttaaaaatttatatt |
7777673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 17815597 - 17815674
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||| ||| ||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
17815597 |
tgaacatgaagttttgcaaatacccccctgatgttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatat |
17815674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 102 - 178
Target Start/End: Original strand, 35058321 - 35058397
Alignment:
Q |
102 |
atgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||| ||||||||||| |||| |||||||||||||||||||||||||| | |||||||||||||||| |||| |
|
|
T |
35058321 |
atgacgttttacaaatatccccctgaaattttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttataatttt |
35058397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 102 - 178
Target Start/End: Original strand, 41425552 - 41425629
Alignment:
Q |
102 |
atgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||| |||| |||||||||||||||||||||||||| |||| |||||||||||||||| |||| |
|
|
T |
41425552 |
atgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaataccccatgaacttgaaaatttataatttt |
41425629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 7338811 - 7338735
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| || ||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
7338811 |
aacataactttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgccctccaaacttgaaaatttatat |
7338735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 34926022 - 34925942
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||| | |||||||||||||||||| ||||||||||||| || ||||| |
|
|
T |
34926022 |
aacatgacgttttgcaaatacccccctgaagttttgtagttatgtgcaaaatgccccctaaacttgaaaattcattttttt |
34925942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 33437960 - 33437882
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||| || ||| |||||||||||| |
|
|
T |
33437960 |
tgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-aaatcttaaaaatttatatt |
33437882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 7277908 - 7277985
Alignment:
Q |
99 |
aacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||| |||| |||||||||||||||| |
|
|
T |
7277908 |
aacatgacgttttgcaaatattccccctgaagttttgcacttatgtgcgaaattccccctggacttgaaaatttatat |
7277985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 10575036 - 10574978
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
T |
10575036 |
cccctgaaattttgcacttatgtgcaaaatgcaccctaaacttgaaaatttatattttt |
10574978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 11871351 - 11871270
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| ||||| |||||| ||||| |||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||| |
|
|
T |
11871351 |
tgaacatgaagttttacaaatacccccttgaagttttgcgcttatgtgcaaaatgtccc-caaacttaaaaatttatattttt |
11871270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 17540330 - 17540264
Alignment:
Q |
113 |
caaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| |||||| |||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
17540330 |
caaatatcctcctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt |
17540264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 23849083 - 23849160
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| |||| |||||||||||| |||||||||||||| ||| | ||||||||||||||||| |
|
|
T |
23849083 |
aacatgatgttttgcaaataccccccctgaagttttgcaattatgtgcaaaatgtcccccgaacttgaaaatttatat |
23849160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 27482231 - 27482173
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
27482231 |
cccctgaaattttgtacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
27482173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 41727055 - 41726997
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
41727055 |
cccctgaaattttgcacttatgtgcaaaatgccctctaaacttgaaaatttatattttt |
41726997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 45159740 - 45159798
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
45159740 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt |
45159798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 29365948 - 29366013
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| ||||||| |||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
29365948 |
caaataccccctgaaattttgcagttatgtgcaaaatgccccctaaacttaaaaatttatattttt |
29366013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 105 - 174
Target Start/End: Complemental strand, 36208005 - 36207936
Alignment:
Q |
105 |
acgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||| ||||| |||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
36208005 |
acgttttgcaaataccccctaaagttttgcacttatgtgcaaaatgctctctgaacttgaaaatttatat |
36207936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 8307414 - 8307338
Alignment:
Q |
99 |
aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||||| ||||| || |||| ||||||| ||||||||| ||| | ||||||||||||||||| |
|
|
T |
8307414 |
aacatgacgttttgcaaatattcccctaaaattttacacttatatgcaaaatgtcccccgaacttgaaaatttatat |
8307338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 20463650 - 20463574
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||| ||||||||||||||| |||| ||||||||| |||||||||||||||||| || ||||||||||||||||| |
|
|
T |
20463650 |
aacacgacgttttgcaaatactcccttgaagttttacacttatgtgcaaaatgctccttgaacttgaaaatttatat |
20463574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 7532618 - 7532540
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaa-tgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| ||||| |||||||||||||||||||||||| |||||| ||| ||| ||||||||||| |
|
|
T |
7532618 |
tgaacatgaagttttgcaaatacccccttgaagttttgcacttatgtgcaaaaatgccccccaa-cttaaaaatttatat |
7532540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 113 - 176
Target Start/End: Complemental strand, 45160296 - 45160233
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| |||||| |||||||| |||| |
|
|
T |
45160296 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattt |
45160233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 5438993 - 5438935
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
5438993 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
5438935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 6082249 - 6082191
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
T |
6082249 |
cccctgaaattttgcacttaagtgcaaaatgccccctaaaattgaaaatttatattttt |
6082191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 18060463 - 18060409
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
18060463 |
cccctgaaattttgcacttatgtgcaaaatgtcccctaaacttgaaaatttatat |
18060409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 28150844 - 28150786
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
28150844 |
cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt |
28150786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 166
Target Start/End: Original strand, 28636238 - 28636307
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaa |
166 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||| |||||||||||||||| |||| | ||||||||| |
|
|
T |
28636238 |
aacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaattccccccgaacttgaaa |
28636307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 41287267 - 41287209
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
41287267 |
cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt |
41287209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 43208992 - 43208934
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
43208992 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
43208934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 7337915 - 7337988
Alignment:
Q |
102 |
atgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||| |||||||||| ||| ||||||||||||||||| |
|
|
T |
7337915 |
atgacgttttgcaaatattttcctgaagttttgcacttaagtgcaaaatgacccttgaacttgaaaatttatat |
7337988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 12139321 - 12139245
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| |||| || ||||||||||||||||||||||||| | | ||||| ||||||||||| |
|
|
T |
12139321 |
aacataacgttttgcaaatacccccctgcagttttgcacttatgtgcaaaatgctctccgaactttaaaatttatat |
12139245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 39500402 - 39500478
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||| ||||| || || |||||||| |||||||||||||||| ||| | ||||||||||||||||| |
|
|
T |
39500402 |
aacatgacgttttgtaaataccctcttgaagttttacacttatgtgcaaaatatcccccgaacttgaaaatttatat |
39500478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 43207005 - 43207061
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||| ||||||| |||||||||||||| ||| |||||||||||||||||||| |
|
|
T |
43207005 |
cccctgaaattttgcatttatgtgcaaaatgtcccctaaacttgaaaatttatattt |
43207061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 5607512 - 5607437
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||| |||||||||||| ||||||| ||||| | | ||||||||||||||||| |
|
|
T |
5607512 |
aacatgacgttttgcaaataccccatgaagttttgcagttatgtgggaaatgtcacctgaacttgaaaatttatat |
5607437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 20207765 - 20207687
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| ||||||| ||||| ||||| || ||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
20207765 |
aacatcacgttttaaaaataccccctaaaattttgcacttatgtgcaaaatacccc-tgaacttgaaaatttatattttt |
20207687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 28150021 - 28150080
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaac-ttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||| || ||||||||||||||| |
|
|
T |
28150021 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaactttaaaaatttatattttt |
28150080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 175
Target Start/End: Original strand, 28586967 - 28587022
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| |||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
T |
28586967 |
cccctgaaattttgcacttatgtgccaaatgccctctaaacttgaaaatttatatt |
28587022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 38939222 - 38939147
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| ||||||| ||||||| ||||||||||||||||||| ||||||||| | ||| || ||||||||||| |
|
|
T |
38939222 |
aacatgaaattttgcagatatcccttgaagttttgcacttatgttcaaaatgccgcctaaatttaaaaatttatat |
38939147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 3364018 - 3363936
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| |||||||| ||| |||| |||| ||||||||| ||||||||||||||| |||| | ||||||||||||||| |
|
|
T |
3364018 |
tgaacatgaagttttgcacatacccccctgaaattttgcactaatgtgcaaaatgcccttcaaatataaaaatttatattttt |
3363936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 152
Target Start/End: Complemental strand, 9759087 - 9759038
Alignment:
Q |
102 |
atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcc |
152 |
Q |
|
|
|||| |||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
9759087 |
atgatgttttgtaaata-cccctgaagttttgcacttatgtgcaaaatgcc |
9759038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 11865515 - 11865591
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| ||||| || ||||||||||||||| |||||||||| | ||||| | |||||||||| |
|
|
T |
11865515 |
tgaacatgaagttttgcaaata-cccctcaaattttgcacttatgtgaaaaatgcccc-cgaacttaataatttatatt |
11865591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 18059635 - 18059693
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
18059635 |
cccctgaaattttgtacttatgtgcaaaatgccccataaacttaaaaatttaaattttt |
18059693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 29366499 - 29366441
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| || |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
29366499 |
cccctaaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
29366441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 2695006 - 2695075
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
T |
2695006 |
tgaacatgacgttttgcaaatat-ccctgaagttt--------tgtgcaaaatgccccccaaacttaaaaatttatatt |
2695075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 129 - 178
Target Start/End: Original strand, 6081120 - 6081169
Alignment:
Q |
129 |
ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
6081120 |
ttttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
6081169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 99 - 151
Target Start/End: Original strand, 9758419 - 9758472
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgc |
151 |
Q |
|
|
||||| |||| |||||||||||||| |||| ||||||||||||||||||||||| |
|
|
T |
9758419 |
aacatcacgtattgcaaatatccccctgaatttttgcacttatgtgcaaaatgc |
9758472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 134 - 175
Target Start/End: Complemental strand, 44258689 - 44258648
Alignment:
Q |
134 |
cacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
44258689 |
cacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
44258648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 96 - 172
Target Start/End: Original strand, 44747081 - 44747157
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
|||||||||||||||| |||||| ||| || ||||||||||||||| ||||||||| ||| | |||||||| |||||| |
|
|
T |
44747081 |
atgaacatgacgttttacaaatacccctctaaagttttgcacttatatgcaaaatgtccc-cgaacttgaatatttat |
44747157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 33437341 - 33437381
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccctgaagttttgcac |
136 |
Q |
|
|
||||||||||| ||||||||||| ||||||||||||||||| |
|
|
T |
33437341 |
atgaacatgacattttgcaaataccccctgaagttttgcac |
33437381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 159
Target Start/End: Original strand, 28636578 - 28636617
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaa |
159 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||| |
|
|
T |
28636578 |
cccctgaaattttgcacttatgtgcaaaatgccccccaaa |
28636617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 41286436 - 41286495
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttg-aaaatttatattttt |
178 |
Q |
|
|
||||| || |||||||||||||||||||| ||||| ||||||| ||||||||||||||| |
|
|
T |
41286436 |
cccctaaaattttgcacttatgtgcaaaacgccccctaaacttgaaaaatttatattttt |
41286495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 27481412 - 27481470
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||| |||||||||||| |||||| |||||||| |||||| |
|
|
T |
27481412 |
cccctgaaattttgcacttatacgcaaaatgccccataaacttaaaaatttagattttt |
27481470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 28587525 - 28587467
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||| |||||||||||||||| |||||| ||||||| |||||| |
|
|
T |
28587525 |
cccctgaaattttgcactaatgtgcaaaatgccccctaaactttcaaatttagattttt |
28587467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 130 - 175
Target Start/End: Original strand, 33437385 - 33437431
Alignment:
Q |
130 |
tttgcacttatgtgcaaaatgccccgcaaactt-gaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
33437385 |
tttgcacttatgtgcaaaatgccccccaaacttaaaaaatttatatt |
33437431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 7278260 - 7278207
Alignment:
Q |
99 |
aacatgacgttttg-caaatatc-ccctgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
||||||||||||| |||||||| ||||||||||||| |||||||||||||||| |
|
|
T |
7278260 |
aacatgacgttttttcaaatatcaccctgaagttttggacttatgtgcaaaatg |
7278207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 147
Target Start/End: Complemental strand, 36208084 - 36208035
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaa |
147 |
Q |
|
|
||||| ||||||||||||| |||| |||||||||||||||||||||||| |
|
|
T |
36208084 |
aacattacgttttgcaaatgcccccctgaagttttgcacttatgtgcaaa |
36208035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 126 - 154
Target Start/End: Original strand, 1090669 - 1090697
Alignment:
Q |
126 |
aagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
1090669 |
aagttttgcacttatgtgcaaaatgcccc |
1090697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 139
Target Start/End: Complemental strand, 28780339 - 28780300
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcactta |
139 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||| |
|
|
T |
28780339 |
aacataacgttttgcaaata-cccctgaagttttgcactta |
28780300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 74; Significance: 1e-33; HSPs: 204)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 40246073 - 40245992
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
T |
40246073 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt |
40245992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30838548 - 30838626
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
30838548 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
30838626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39628509 - 39628587
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
39628509 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
39628587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39628928 - 39628850
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
39628928 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
39628850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 44335281 - 44335359
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
44335281 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
44335359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 21176095 - 21176176
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||| |
|
|
T |
21176095 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgtaaaatgccccccaaacttaaaaatttatattttt |
21176176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 100 - 175
Target Start/End: Original strand, 3628074 - 3628149
Alignment:
Q |
100 |
acatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
3628074 |
acatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
3628149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 35500576 - 35500497
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
35500576 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
35500497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36644167 - 36644246
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36644167 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
36644246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43774659 - 43774738
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
43774659 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
43774738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37231395 - 37231317
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
37231395 |
tgaacatgacgttttgcaaacatcccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
37231317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41081004 - 41080926
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
41081004 |
tgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
41080926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 46230191 - 46230114
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
46230191 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
46230114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 10463948 - 10463869
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||| |||||||| |
|
|
T |
10463948 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaagtttatatt |
10463869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17271917 - 17271996
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
17271917 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
17271996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 21459466 - 21459388
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
21459466 |
aacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgccccataaatttgaaaatttatattttt |
21459388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26303418 - 26303497
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
26303418 |
tgaacatgacgttttgcaaatatccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
26303497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 28290142 - 28290221
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
28290142 |
tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
28290221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40668059 - 40668138
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
40668059 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
40668138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 44335889 - 44335810
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
44335889 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
44335810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 44744393 - 44744472
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
44744393 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
44744472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 46100869 - 46100790
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
46100869 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
46100790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 46949634 - 46949560
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
46949634 |
aacatgacgttttgcaaatacccccggaagttttgcacttatgtgcaaaatgcccc-caaacttgaaaatttatat |
46949560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21176700 - 21176622
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
21176700 |
tgaacatgacgttttacaaataccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
21176622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 35004324 - 35004401
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
35004324 |
tgaacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaattccccccaaacttaaaaatttatatt |
35004401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 35788290 - 35788367
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
35788290 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatacccc-caaacttaaaaatttatatt |
35788367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39403522 - 39403445
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
39403522 |
tgaacatgacgttttgcaaataccccc-gaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
39403445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42029194 - 42029117
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
42029194 |
tgaacatgacgttttgcaaataccccctgaagttt-gcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
42029117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43670725 - 43670802
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
43670725 |
tgaacatgacattttgcaaata-cccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
43670802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 43775524 - 43775447
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
43775524 |
tgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
43775447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 44388376 - 44388294
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
T |
44388376 |
tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt |
44388294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7337897 - 7337817
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
7337897 |
tgaacatgacgttttgcaaatacccaccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
7337817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 34994655 - 34994575
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
34994655 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
34994575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 44745001 - 44744924
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
44745001 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
44744924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 45155044 - 45155124
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
45155044 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
45155124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 45155655 - 45155575
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
45155655 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
45155575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 97 - 176
Target Start/End: Original strand, 18928218 - 18928298
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
18928218 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttttaaatttatattt |
18928298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6804891 - 6804812
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6804891 |
tgaacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
6804812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8641033 - 8641112
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
8641033 |
tgaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt |
8641112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8641641 - 8641563
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
8641641 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
8641563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 17272526 - 17272447
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
17272526 |
tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
17272447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 18121424 - 18121346
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
18121424 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
18121346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 21458743 - 21458822
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||||||| || |||||||||||||| ||||||||||| ||| |||||||||||||||||| |
|
|
T |
21458743 |
aacatgacgttttgcaaatatcccctaaaattttgcacttatgtacaaaatgccccttaaatttgaaaatttatattttt |
21458822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 34962508 - 34962586
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
34962508 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
34962586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 34963111 - 34963032
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
34963111 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt |
34963032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 34993776 - 34993855
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
34993776 |
tgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
34993855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36787381 - 36787302
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| | |||||||||||||||| |||||||||||| ||||||| |||||||||||| |
|
|
T |
36787381 |
tgaacatgacgttttgcaaatatccccctaaagttttgcacttatgcgcaaaatgccccccaaacttaaaaatttatatt |
36787302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37007801 - 37007722
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
37007801 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt |
37007722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38171638 - 38171559
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||| | |||||||||||| |
|
|
T |
38171638 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt |
38171559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38354105 - 38354184
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
38354105 |
tgaacatgacgttttgcaaatacccacctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
38354184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 101 - 175
Target Start/End: Complemental strand, 38354710 - 38354635
Alignment:
Q |
101 |
catgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
38354710 |
catgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
38354635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43082389 - 43082467
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
43082389 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgtccc-caaacttaaaaatttatatt |
43082467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 47170932 - 47170853
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
47170932 |
tgaacatgacgtttcgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
47170853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 18031691 - 18031613
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
18031691 |
gaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
18031613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36786774 - 36786851
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
36786774 |
tgaacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatacccc-caaacttaaaaatttatatt |
36786851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39402917 - 39402994
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| || | ||||| |||||||||||| |
|
|
T |
39402917 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgctcc-ccaacttaaaaatttatatt |
39402994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 44781930 - 44781852
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||| |||| ||||||| ||||||||||| |
|
|
T |
44781930 |
tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaattcccctcaaacttaaaaatttatat |
44781852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7462921 - 7462841
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
7462921 |
tgaacatgatgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
7462841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38171035 - 38171115
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
38171035 |
tgaagatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
38171115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 23678840 - 23678760
Alignment:
Q |
99 |
aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| ||||||| |||||| | |||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
23678840 |
aacatcacgttttacaaatacctccctgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttatattttt |
23678760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 40245197 - 40245273
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata |
173 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||| ||||||| |||||||||| |
|
|
T |
40245197 |
gaacatgacgttttgcaaatatcctcctgaagttttacacttatgtgcaaaatgtcccccaaacttaaaaatttata |
40245273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 104 - 175
Target Start/End: Complemental strand, 43671602 - 43671530
Alignment:
Q |
104 |
gacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
43671602 |
gacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccacccaaacttaaaaatttatatt |
43671530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7337298 - 7337377
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
7337298 |
tgaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
7337377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 14102952 - 14103031
Alignment:
Q |
99 |
aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| | |||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
14102952 |
aacataacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgccccctaaatttgaaaatttatatttt |
14103031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 14412969 - 14413048
Alignment:
Q |
99 |
aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| | |||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
14412969 |
aacataacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgccccctaaatttgaaaatttatatttt |
14413048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17897166 - 17897245
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||| ||| |||||||||||| |
|
|
T |
17897166 |
tgaacatgacgttttgcaaatacccttctgaagttttgcacttatgtgcaaaatgccccccaagcttaaaaatttatatt |
17897245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 18031081 - 18031160
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| | |||||||||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
18031081 |
tgaacatgacgttttgcaaatacccccctaaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttatatt |
18031160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 19488716 - 19488794
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
19488716 |
tgaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
19488794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 102 - 178
Target Start/End: Complemental strand, 24213339 - 24213261
Alignment:
Q |
102 |
atgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||| |||||| || |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
24213339 |
atgacgttttgcaaatacctcccctcaaattttgcacttatgtgcaaaatgccccttaaacttgaaaatttatattttt |
24213261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 26928208 - 26928283
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
26928208 |
aacatgatgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttatat |
26928283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41409007 - 41409086
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |||| ||||||| |
|
|
T |
41409007 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaactaaaaaaattatatt |
41409086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 46100260 - 46100339
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
46100260 |
tgaacattacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
46100339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 11455553 - 11455630
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata |
173 |
Q |
|
|
||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
T |
11455553 |
gaacatgacattttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata |
11455630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 29418099 - 29418018
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
29418099 |
aacatgacattttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatattttt |
29418018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 35004928 - 35004852
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
35004928 |
tgaacatgacattttgcaaata-cccctgaagttttgcacttatgtgcaaaattcccc-caaacttaaaaatttatatt |
35004852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 36709397 - 36709455
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
36709397 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgcccc |
36709455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6804010 - 6804090
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6804010 |
tgaacatgatgttttgcaagtactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
6804090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 101 - 178
Target Start/End: Complemental strand, 8124939 - 8124862
Alignment:
Q |
101 |
catgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||| |||||||| |||||||||||| | ||||||| || ||||||||||||||||||||||| |
|
|
T |
8124939 |
catgacgttttgcaaataccccctgaaattttgcacttatatacaaaatgttcctcaaacttgaaaatttatattttt |
8124862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24182620 - 24182540
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||| ||||||| |
|
|
T |
24182620 |
tgaacataacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaaattatatt |
24182540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 162
Target Start/End: Original strand, 26342731 - 26342796
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaactt |
162 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
26342731 |
tgaacatgacgttttgcaaataccctctgaagttttgcacttatgtgcaaaatgccctccaaactt |
26342796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 99 - 173
Target Start/End: Original strand, 30162546 - 30162622
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata |
173 |
Q |
|
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| ||||||| |||||||||| |
|
|
T |
30162546 |
aacatgacgttttgcaaacatcctccctgaagtttttcacttatgtgcaaaatgccccccaaacttaaaaatttata |
30162622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 34345372 - 34345437
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
34345372 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
34345437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41409557 - 41409477
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| ||||| | |||||||||||| |
|
|
T |
41409557 |
tgaacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccaaacataaaaatttatatt |
41409477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 173
Target Start/End: Complemental strand, 41642223 - 41642146
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata |
173 |
Q |
|
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||| || |||||||||| |
|
|
T |
41642223 |
tgaacataacgttttgcaaatatccctctgaagttttgcacttatgtgcaaaatgcccccaaaatttaaaaatttata |
41642146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 43759622 - 43759702
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| ||||||| |||||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
43759622 |
aacataacgttttccaaataccccctctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatttt |
43759702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 99 - 152
Target Start/End: Complemental strand, 44950682 - 44950629
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcc |
152 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
44950682 |
aacatgacgttttgcaaatatcccctgaagttttgcagttatgtgcaaaatgcc |
44950629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 48936291 - 48936368
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||| | ||||| |||||||||||| |
|
|
T |
48936291 |
aacatgacgttttgcagatacccccatgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatatt |
48936368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 22114003 - 22114086
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| ||| ||||||||||| |||| ||||||||| ||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
22114003 |
tgaacacgacattttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatattttt |
22114086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 24212441 - 24212517
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||| | ||| ||||||||||||| |
|
|
T |
24212441 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccctccgaacatgaaaatttatat |
24212517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 26831664 - 26831740
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
26831664 |
aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccccatgaacttgaaaatttatat |
26831740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 29417259 - 29417339
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| ||||||||||||| || ||||| |
|
|
T |
29417259 |
aacatgacgttttgcaaatacccccctgaagttttgcagttatgtgcaaaatgccccctaaacttgaaaattcattttttt |
29417339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 33697307 - 33697231
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
33697307 |
aacatgatgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatat |
33697231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 40525438 - 40525355
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| ||| ||||||||||| |||| ||||||||| ||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
40525438 |
tgaacacgacattttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatattttt |
40525355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 107 - 178
Target Start/End: Complemental strand, 4288310 - 4288239
Alignment:
Q |
107 |
gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| |||||||||||||| |||||||||||||||||| | | || |||||||||||||||||| |
|
|
T |
4288310 |
gttttgcaaataccccctgaagttttgtacttatgtgcaaaatgcctcccgaaattgaaaatttatattttt |
4288239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 5211197 - 5211119
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| |||| |||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||| |
|
|
T |
5211197 |
aacatgatattttacaaataccccctgaagttttgcacttatgtgcaaaatgctcc-caaacttaaaaatttatattttt |
5211119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 18829198 - 18829273
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| ||| ||||||||||||||||||||||||||||| | | ||||||||||| ||||| |
|
|
T |
18829198 |
aacatcacgttttgcaaataccccttgaagttttgcacttatgtgcaaaatgcctcccgaacttgaaaatatatat |
18829273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 23379137 - 23379059
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| ||| |||||||| |
|
|
T |
23379137 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-aaaacttaaaattttatatt |
23379059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24182009 - 24182088
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||||| |||| ||||||| |
|
|
T |
24182009 |
tgaacatgacgttttgcaaatacccccccgaagttttgcacttatgtgccaaatgccccccaaacttaaaaaattatatt |
24182088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24466434 - 24466513
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaa-atgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||| || ||| ||||||| |||||||||||| |
|
|
T |
24466434 |
tgaacatgacgttttgcaaataccccttgaagttttgcacttatgtgcaaatataacccccaaacttaaaaatttatatt |
24466513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 26832587 - 26832508
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgc-aaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||| | ||| | ||||||||||||||| |
|
|
T |
26832587 |
aacataacgtttggcaaataccccctgaagttttgcacttatgtgcaaaatgcccccctaaattggaaaatttatatttt |
26832508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30890346 - 30890425
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||| ||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
30890346 |
tgaacatgacgttttgcaaataccccctcaagttttacacttatgtgcaaaatgtccctccaaacttaaaaatttatatt |
30890425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 107 - 174
Target Start/End: Complemental strand, 31309357 - 31309290
Alignment:
Q |
107 |
gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||| ||| ||||||||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
31309357 |
gttttgcaaataccccttgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatat |
31309290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 34959118 - 34959043
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| ||||||||||||| ||||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
34959118 |
aacattacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgtcccctgaacttgaaaatttatat |
34959043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 36897527 - 36897602
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| | |||||||||||||||| | ||||||||||||||||| |
|
|
T |
36897527 |
aacatgacgttttgcaaataccccctgaagttttgtatttatgtgcaaaatgcctccttaacttgaaaatttatat |
36897602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 38184330 - 38184389
Alignment:
Q |
119 |
tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
38184330 |
tcccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
38184389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 164
Target Start/End: Original strand, 40524715 - 40524782
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga |
164 |
Q |
|
|
|||||||||| ||||||||||| ||||||||||||||||||| ||||||||||| ||| ||||||||| |
|
|
T |
40524715 |
tgaacatgacattttgcaaataccccctgaagttttgcacttgtgtgcaaaatgtcccccaaacttga |
40524782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 108 - 175
Target Start/End: Complemental strand, 40668655 - 40668589
Alignment:
Q |
108 |
ttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
40668655 |
ttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt |
40668589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41080397 - 41080475
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| | |||||||||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
41080397 |
tgaacatgacgttttgcaaatacccccctaaagttttgca-ttatgtgcaaaatgccccccaaacttaaaaatttatatt |
41080475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42028586 - 42028665
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||| ||||||||| |||| |||||||||||||||||||| |||||||||| ||||||| ||| |||||||| |
|
|
T |
42028586 |
tgaacatgacgtattgcaaatacccccctgaagttttgcacttatgtgtaaaatgccccccaaacttaaaattttatatt |
42028665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 48611251 - 48611196
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
T |
48611251 |
aacatgacgttttgcaaataccccccgaagttttgcacttatgtgcaaaatgcccc |
48611196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 48937167 - 48937089
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| |||||||||||||||| || |||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
48937167 |
tgaacatgtcgttttgcaaatatcctcttgaagttttgcacttatgtgcaaaatgcccc-aaaacttaaaaatttatatt |
48937089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 105 - 174
Target Start/End: Original strand, 4287071 - 4287141
Alignment:
Q |
105 |
acgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||| |||| ||||||||||||||||||||| ||||||||| | ||||||||||||||||| |
|
|
T |
4287071 |
acgttttgcaaatacccccctgaagttttgcacttatgtgctaaatgccccccgaacttgaaaatttatat |
4287141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 7462035 - 7462110
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||| ||||||| || ||||||||||||||| ||||||||||||||| ||||||| ||||||||||| |
|
|
T |
7462035 |
tgaacatgacgtttcgcaaataccctctgaagttttgcact--tgtgcaaaatgcccctcaaacttcaaaatttatat |
7462110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 105 - 178
Target Start/End: Original strand, 31308379 - 31308452
Alignment:
Q |
105 |
acgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
31308379 |
acgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgcccc-tgaacttgaaaatttatattttt |
31308452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 36900726 - 36900645
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtg--caaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| |||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
T |
36900726 |
aacataacgttttgcaaatacccccctgaagttttgcacttatgtgtgcaaaatgccccctaaacttgaaaatttatatttt |
36900645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 45259614 - 45259537
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
45259614 |
aacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccgaacttcaaaatttatat |
45259537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 48610762 - 48610839
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||| | | ||||||||||||||||| |
|
|
T |
48610762 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcaacccgaacttgaaaatttatat |
48610839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 3628679 - 3628599
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| ||||||||||||| || |||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
3628679 |
tgaacgtgacgttttgcaagtaccccccctgaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttatatt |
3628599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 19072129 - 19072072
Alignment:
Q |
121 |
ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
19072129 |
ccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
19072072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 48343718 - 48343783
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| ||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
48343718 |
caaataccccttgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
48343783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 104 - 175
Target Start/End: Complemental strand, 1730209 - 1730137
Alignment:
Q |
104 |
gacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||| | ||||||| ||||| |||||| |
|
|
T |
1730209 |
gacgttttacaaatattcccctgaagttttgcacttatgtgcaaaatgcctctcaaacttaaaaatatatatt |
1730137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 175
Target Start/End: Complemental strand, 24646847 - 24646779
Alignment:
Q |
108 |
ttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||| |||| |||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
24646847 |
ttttgcaaatacccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaatttatatt |
24646779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 30023217 - 30023141
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| |||| ||||||||||||||||||||||||||| || ||||||| ||||||||||| |
|
|
T |
30023217 |
aacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcctccaaacttaaaaatttatat |
30023141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 170
Target Start/End: Complemental strand, 35499312 - 35499240
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||| ||||||| ||||||||||||| | ||||||||||||| |
|
|
T |
35499312 |
aacatgacgttttgcaaatacccccctgaagttttacacttatttgcaaaatgccccccgaacttgaaaattt |
35499240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 40341170 - 40341111
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
T |
40341170 |
tgaacatgacgttttgcaaatacctcccctgaagttttgcacttatgtgcaaagtgcccc |
40341111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 44378927 - 44379005
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||| | |||||||| |||||||| |
|
|
T |
44378927 |
aacatgacgttttgcaaatatccccccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaagatttatat |
44379005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 44387794 - 44387872
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||| | |||||||| |||||||| |
|
|
T |
44387794 |
aacatgacgttttgcaaatatccccccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaagatttatat |
44387872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 2755989 - 2755910
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| | |||| |||| ||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
T |
2755989 |
tgaacatgacgttttacgaatactcccatgaagttttgcacttatgtgcaaaatgccccatgaacttaaaaatttatatt |
2755910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 17774427 - 17774501
Alignment:
Q |
102 |
atgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
17774427 |
atgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctgaaattgaaaatttatat |
17774501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 107 - 174
Target Start/End: Original strand, 21124956 - 21125023
Alignment:
Q |
107 |
gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||| |||||||| |||||||||||| ||||||||||||| | ||||| ||||||||||| |
|
|
T |
21124956 |
gttttgcaaataccccctgaaattttgcacttatctgcaaaatgccccccgaactttaaaatttatat |
21125023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 21366403 - 21366458
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
21366403 |
ctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
21366458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 107 - 174
Target Start/End: Original strand, 33227811 - 33227878
Alignment:
Q |
107 |
gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
33227811 |
gttttacaaataccccctgaagttttgcacttatgtgcaaaatgcccgttgaacttgaaaatttatat |
33227878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 37007190 - 37007268
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| ||||||||||||||||| ||||||||| |||| |||||| |||||||||||| |
|
|
T |
37007190 |
tgaacatgacgttttgcaaatacccctctgaagttttgcacttacgtgcaaaatacccc-aaaacttaaaaatttatatt |
37007268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 45856920 - 45856999
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| ||||| || |||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
45856920 |
tgaacatgatgttttgcaaatacccccttaaagttttgcacttatgtgcaaaataccctccaaacttaaaaatttatatt |
45856999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 1493750 - 1493704
Alignment:
Q |
108 |
ttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
1493750 |
ttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc |
1493704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 21125642 - 21125585
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
T |
21125642 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc |
21125585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 35498754 - 35498812
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
T |
35498754 |
tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc |
35498812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 44472792 - 44472710
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| ||||||||||| ||| ||||||||||||| |||||||||||| | || ||||||||||||||||||||||| |
|
|
T |
44472792 |
tgaacatgatattttgcaaatacccctctgaagttttgcatttatgtgcaaaaagttccccaaacttgaaaatttatattttt |
44472710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 46229577 - 46229662
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttat------gtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||| ||||||| |||||||||||| |
|
|
T |
46229577 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaagtgcaaaatgccccccaaacttaaaaatttatatt |
46229662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 22599455 - 22599375
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| | ||||||||||| ||||||||||||||||| ||| | ||||| || ||||||||| |
|
|
T |
22599455 |
tgaacatgacgttttgcaaatatactccctgaagttttacacttatgtgcaaaatgtcccacgaacttaaatatttatatt |
22599375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 153
Target Start/End: Original strand, 26931423 - 26931480
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccc |
153 |
Q |
|
|
|||||||||||||||||||||| |||| | |||||||||||||||||||||||||||| |
|
|
T |
26931423 |
tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccc |
26931480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 47170319 - 47170402
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc------tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
47170319 |
tgaacatgacgttttgcaaataccccccccccctgaggttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
47170402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 5198364 - 5198440
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||| |||||| | ||||||||||||||||||||||||||||||| | | ||||| ||||||||||| |
|
|
T |
5198364 |
aacatgacattttgtaaatattctcctgaagttttgcacttatgtgcaaaatgccacccgaacttaaaaatttatat |
5198440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 120 - 175
Target Start/End: Original strand, 12231270 - 12231326
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgc-aaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
T |
12231270 |
cccctgaaattttgcacttatgtgcaaaatgcccccctaaacttgaaaatttatatt |
12231326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 26932033 - 26931950
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata--tcccctgaagttttgcact----tatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
26932033 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatatatgtgcaaaatgcccc-caaacttaaaaatttatatt |
26931950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 29644965 - 29644889
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| |||| ||| ||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
T |
29644965 |
aacatgatgttttgcaaatacccccctgaggttttgcacttatgtgcaaaatgccccatgaacttgaaaatatatat |
29644889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 33228543 - 33228467
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| ||||||||||| |||| |||| |||||||||||||||||||||||||| | |||||||| |||||||| |
|
|
T |
33228543 |
aacatgaaattttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccgaacttgaatatttatat |
33228467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 33696623 - 33696699
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| ||| |||||||| || |||| ||||||||||||||||||||||||| || | ||||||||||||||||| |
|
|
T |
33696623 |
aacatgatgttctgcaaataacctcctggagttttgcacttatgtgcaaaatgctccccgaacttgaaaatttatat |
33696699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 8296385 - 8296440
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
8296385 |
ctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt |
8296440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 119 - 174
Target Start/End: Original strand, 16083138 - 16083193
Alignment:
Q |
119 |
tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
16083138 |
tcccctgaaattttgcacttatgtgcaaaatgacccttaaacttgaaaatttatat |
16083193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 18120383 - 18120462
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||| ||||| |||| ||||||||||||||||||||| | ||| ||| ||||||| |||||||||||| |
|
|
T |
18120383 |
tgaacatgatgttttggaaatacccccctgaagttttgcacttatgtgcgatatgtcccccaaacttaaaaatttatatt |
18120462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 18830197 - 18830123
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||| | |||| ||||||||||||||||||||| |||||||||||| | ||||| ||||||||||| |
|
|
T |
18830197 |
aacatgacgttttcctaataccccctgaagttttgcacttataagcaaaatgcccc-cgaacttaaaaatttatat |
18830123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 113 - 171
Target Start/End: Complemental strand, 12231967 - 12231909
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
||||||||||| ||| |||||||||||||||||||||||||| |||||| |||||||| |
|
|
T |
12231967 |
caaatatcccccgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
12231909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 15752357 - 15752438
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||| |||||||||| | | |||||||||||||||||||| || ||| ||||||||||||||||||||| |
|
|
T |
15752357 |
aacatgacgttttgtaaatatcccccttaacgttttgcacttatgtgcaaagtgtcccttgaacttgaaaatttatattttt |
15752438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 102 - 167
Target Start/End: Complemental strand, 17775276 - 17775210
Alignment:
Q |
102 |
atgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa |
167 |
Q |
|
|
|||||||||| |||||| || |||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
T |
17775276 |
atgacgttttacaaatactctcctgaagttttgcagttatgtgcaaaatgccccctaaacttgaaaa |
17775210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 19071598 - 19071656
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
19071598 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
19071656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 28294397 - 28294455
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
28294397 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
28294455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 28311642 - 28311700
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
28311642 |
cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt |
28311700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 35667918 - 35667976
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
35667918 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
35667976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 39767530 - 39767472
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
39767530 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
39767472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 124 - 174
Target Start/End: Original strand, 45259058 - 45259108
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||||||||| ||||||| ||||||||||| |
|
|
T |
45259058 |
tgaagttttgcacttatgtgtaaaatgccccccaaacttaaaaatttatat |
45259108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 97 - 149
Target Start/End: Complemental strand, 5852486 - 5852433
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaat |
149 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||| |||||| |
|
|
T |
5852486 |
tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtacaaaat |
5852433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 166
Target Start/End: Original strand, 9494951 - 9495004
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaa |
166 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||| || | ||||||||| |
|
|
T |
9494951 |
caaataccccctgaagttttgcacttatgtgcaaaatgcaccccgaacttgaaa |
9495004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 178
Target Start/End: Complemental strand, 9495662 - 9495589
Alignment:
Q |
102 |
atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||| |||||| ||||||||||||||||||||||| |||||||| | | ||||||||||||||| ||||| |
|
|
T |
9495662 |
atgacgttttccaaata--ccctgaagttttgcacttatgtgtaaaatgccac-cgaacttgaaaatttatgttttt |
9495589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 11456432 - 11456352
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| ||||| ||||| |||||||||||||||||||| | | |||||| |||||||||||| |
|
|
T |
11456432 |
tgaacatgacgttttgcaaatgtcccccctgaaggtttgcacttatgtgcaaaataactcccaaactaaaaaatttatatt |
11456352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 37710695 - 37710744
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt |
169 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
37710695 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatt |
37710744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 40260553 - 40260488
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| ||||||| ||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
40260553 |
caaatattccctgaaattttgcacttatgtgcaaaatgccctctaaacttaaaaatttagattttt |
40260488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 41798447 - 41798512
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| ||||| || |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
41798447 |
caaataccccctaaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
41798512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 22992099 - 22992174
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| | || ||||||||||||||||||||| || | | ||||||||||||||||| |
|
|
T |
22992099 |
aacatgacgttttgcaaatacccccctaaaattttgcacttatgtgcaaaattcctc-cgaacttgaaaatttatat |
22992174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 27316310 - 27316366
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| |||| | ||||||||||||||||||||| ||||||| |
|
|
T |
27316310 |
aacatgacgttttgcaaatacccccctcaagttttgcacttatgtgcaacatgcccc |
27316366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 102 - 178
Target Start/End: Original strand, 42260819 - 42260895
Alignment:
Q |
102 |
atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||| ||||| ||||| || |||||||||||| |||||||||| || || |||||||||||||||||| |
|
|
T |
42260819 |
atgacgttttgtaaataccccctaaaattttgcacttatatgcaaaatgctccatgaatttgaaaatttatattttt |
42260895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 22022956 - 22022881
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||||||||| | ||||||||||||||||||| ||||||| | || | ||| ||||||||||||| |
|
|
T |
22022956 |
aacatgacattttgcaaatacctcctgaagttttgcacttataggcaaaatacaccccgaacatgaaaatttatat |
22022881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 30163467 - 30163392
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| ||||| |||||| ||| ||| ||||||||||||||||||||| |||| |||||| ||||||||||| |
|
|
T |
30163467 |
aacatgaaattttgtaaatattccccgaaattttgcacttatgtgcaaaataccccctaaacttaaaaatttatat |
30163392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 33210419 - 33210470
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
33210419 |
ctgaaattttgcacttatgtgcaaaatgtcccctaaacttgaaaatttatat |
33210470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 149
Target Start/End: Complemental strand, 34486829 - 34486778
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaat |
149 |
Q |
|
|
|||||||||||||||||||| ||||||| |||||| |||||||||||||||| |
|
|
T |
34486829 |
aacatgacgttttgcaaatactcccctggagttttacacttatgtgcaaaat |
34486778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 112 - 174
Target Start/End: Original strand, 44157603 - 44157666
Alignment:
Q |
112 |
gcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
44157603 |
gcaaatatccccttgaagttttgcacttatgtgcaaaatgcttcatgaacttgaaaatttatat |
44157666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 4236277 - 4236327
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
|||| ||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
4236277 |
cccccgaaattttgcacttatgtgcaaaatgccccataaacttgaaaattt |
4236327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 4237101 - 4237043
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| || |||||||||||||||||||||||||| |||||| ||| ||||||||||| |
|
|
T |
4237101 |
cccctcaaattttgcacttatgtgcaaaatgccccataaacttaaaagtttatattttt |
4237043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 16083712 - 16083654
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||| |||||| |||||||| |||||| |
|
|
T |
16083712 |
cccctgaaattttgcacttatgtgcaaaatgacccttaaacttaaaaatttagattttt |
16083654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 22598914 - 22598991
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| || ||||| |||||||||| |||||||||||| | | ||||||||||||||||| |
|
|
T |
22598914 |
tgaacatgacgttttgcaaatacacctctgaaattttgcacttttgtgcaaaatgcttc-cgaacttgaaaatttatat |
22598991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 37711242 - 37711188
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
37711242 |
tgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
37711188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 38184876 - 38184818
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||||| |||||||| |||| |||||| |||||||| |||||| |
|
|
T |
38184876 |
cccctgaaattttgcacttatgcgcaaaatgtcccgtaaacttaaaaatttagattttt |
38184818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 38449965 - 38450019
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||| |||||| ||||||||||| |
|
|
T |
38449965 |
cccctgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaatttatat |
38450019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 38450666 - 38450600
Alignment:
Q |
113 |
caaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||| ||| |||||| |||||||| |||||| |
|
|
T |
38450666 |
caaatatccccttgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaatttagattttt |
38450600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 39880711 - 39880653
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
39880711 |
cccctgatattttgcacttatgtgcaaaatgccccttaaacttaaaaatttagattttt |
39880653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 174
Target Start/End: Complemental strand, 34345907 - 34345846
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||| ||||| || |||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
34345907 |
caaataccccctaaaattttgcacttatgtgcaaaatgtcccctcaacttgaaaatttatat |
34345846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 129 - 178
Target Start/End: Complemental strand, 35668455 - 35668406
Alignment:
Q |
129 |
ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||| |||||||||| |||||| ||||||||||||||| |
|
|
T |
35668455 |
ttttgcacttatgtgtaaaatgccccctaaacttaaaaatttatattttt |
35668406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 154
Target Start/End: Original strand, 39880164 - 39880205
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| |
|
|
T |
39880164 |
caaataccccctgaaattttgcacttatgtgcaaaatgcccc |
39880205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 48344279 - 48344214
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| ||||||||||||||| ||||||||| |||||| |||||||| |||||| |
|
|
T |
48344279 |
caaataccccctgaaattttgcacttatgtgataaatgccccctaaacttaaaaatttagattttt |
48344214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 39766980 - 39767036
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||| |||||||||| | |||||||| |||| |||||||||||||||||||| |
|
|
T |
39766980 |
cccctgaaattttgcacttctatgcaaaataccccctaaacttgaaaatttatattt |
39767036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 42491417 - 42491341
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||| |||||||| |||||| |||| ||||||||| |||||||||||||||| ||| | ||||| ||||||||||| |
|
|
T |
42491417 |
aacacgacgttttacaaatacccccctgaagttttatacttatgtgcaaaatgtccctcgaacttaaaaatttatat |
42491341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 14103871 - 14103794
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgca--aacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||| |||||| |||| |||||||||| | ||||||| |||||||||| || ||||||||||||||||| |
|
|
T |
14103871 |
aacatgacgtttttcaaatacccccctgaagttttgtatttatgtgtaaaatgcccc-catgaacttgaaaatttatat |
14103794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 14413888 - 14413811
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgca--aacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||| |||||| |||| |||||||||| | ||||||| |||||||||| || ||||||||||||||||| |
|
|
T |
14413888 |
aacatgacgtttttcaaatacccccctgaagttttgtatttatgtgtaaaatgcccc-catgaacttgaaaatttatat |
14413811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 15753279 - 15753201
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| ||||||| ||||||||||| ||||||||||| |||||| ||| ||||| ||||||||| ||||| |
|
|
T |
15753279 |
aacatgacgttt-gcaaataccccctgaagttatgcacttatgtacaaaatatcccctgaacttaaaaatttatgttttt |
15753201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 151
Target Start/End: Original strand, 19557437 - 19557484
Alignment:
Q |
104 |
gacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc |
151 |
Q |
|
|
||||||||||||||| | | |||||||||||| ||||||||||||||| |
|
|
T |
19557437 |
gacgttttgcaaataccacgtgaagttttgcatttatgtgcaaaatgc |
19557484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 167
Target Start/End: Complemental strand, 28312467 - 28312420
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa |
167 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||| |
|
|
T |
28312467 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaactttaaaa |
28312420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 154
Target Start/End: Original strand, 14313050 - 14313084
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |
|
|
T |
14313050 |
cccctgaaattttgcacttatgtgcaaaatgcccc |
14313084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 14313611 - 14313553
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||| ||||| ||||||||||| |||||| |||||||| |||||| |
|
|
T |
14313611 |
cccctgaaattttgcacctatgtacaaaatgccccctaaacttaaaaatttagattttt |
14313553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 103 - 152
Target Start/End: Complemental strand, 21387200 - 21387150
Alignment:
Q |
103 |
tgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgcc |
152 |
Q |
|
|
|||| ||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
T |
21387200 |
tgacattttgcaaatacccctctgaagttttgtacttatgtgcaaaatgcc |
21387150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 97 - 134
Target Start/End: Original strand, 24646297 - 24646335
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat-cccctgaagttttgc |
134 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
24646297 |
tgaacatgacgttttgcaaatatccccctgaagttttgc |
24646335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 165
Target Start/End: Original strand, 28293530 - 28293575
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaa |
165 |
Q |
|
|
|||||||| |||||||||||||||| ||||||||| ||||||||| |
|
|
T |
28293530 |
cccctgaaattttgcacttatgtgcgaaatgccccataaacttgaa |
28293575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 120 - 152
Target Start/End: Complemental strand, 10546590 - 10546558
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgcc |
152 |
Q |
|
|
||||| ||||||||||||||||||||||||||| |
|
|
T |
10546590 |
cccctaaagttttgcacttatgtgcaaaatgcc |
10546558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 144
Target Start/End: Complemental strand, 17898014 - 17897974
Alignment:
Q |
105 |
acgttttgcaaatatccc-ctgaagttttgcacttatgtgc |
144 |
Q |
|
|
|||||||||||||| ||| |||||||||||||||||||||| |
|
|
T |
17898014 |
acgttttgcaaataccccactgaagttttgcacttatgtgc |
17897974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 44679101 - 44679153
Alignment:
Q |
99 |
aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
|||||||||||||||||||||| |||||| ||||||||| || ||||||||| |
|
|
T |
44679101 |
aacatgacgttttgcaaatatcttcctgaaattttgcactaatatgcaaaatg |
44679153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0196 (Bit Score: 70; Significance: 3e-31; HSPs: 1)
Name: scaffold0196
Description:
Target: scaffold0196; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 6575 - 6494
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
T |
6575 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt |
6494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 69; Significance: 1e-30; HSPs: 189)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 98 - 178
Target Start/End: Complemental strand, 29119831 - 29119751
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||||| |
|
|
T |
29119831 |
gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatattttt |
29119751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 14244401 - 14244479
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
14244401 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
14244479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 14450711 - 14450633
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
14450711 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
14450633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 29119222 - 29119300
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
29119222 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
29119300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 9737106 - 9737030
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
9737106 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
9737030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 10443193 - 10443272
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
10443193 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
10443272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 15731491 - 15731570
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
15731491 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
15731570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 15732101 - 15732022
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
15732101 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
15732022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 18809704 - 18809783
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
18809704 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
18809783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 40520912 - 40520833
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
40520912 |
atgaacatgacgttttgcaaataccacctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
40520833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1077322 - 1077399
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
1077322 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
1077399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1587984 - 1588062
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
1587984 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
1588062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7723260 - 7723338
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
7723260 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
7723338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7723866 - 7723788
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
7723866 |
tgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
7723788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 9116208 - 9116130
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||| |||||||||||| |
|
|
T |
9116208 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatatgcaaaataccccccaaacttaaaaatttatatt |
9116130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36508470 - 36508392
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36508470 |
tgaacatgacgttttacaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
36508392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 43433643 - 43433566
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
43433643 |
tgaacatgacgttttgcaaatatccc-tgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
43433566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 43924290 - 43924212
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
43924290 |
tgaatatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
43924212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 35771641 - 35771721
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
35771641 |
tgaacataacgttttgcaaatatcccatgaaattttgcacttatgtgcaaaatgccccg-aaacttgaaaatttatattttt |
35771721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 97 - 176
Target Start/End: Original strand, 43084954 - 43085034
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
T |
43084954 |
tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattt |
43085034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 355916 - 355837
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
355916 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
355837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 104 - 175
Target Start/End: Complemental strand, 5220468 - 5220397
Alignment:
Q |
104 |
gacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
5220468 |
gacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
5220397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 14053929 - 14053850
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
14053929 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
14053850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 15207577 - 15207656
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
15207577 |
tgaacatgacgttttgcaaatacttccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt |
15207656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21559785 - 21559706
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
21559785 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
21559706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24573406 - 24573485
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
24573406 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
24573485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 25630312 - 25630391
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
25630312 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccctgaacttgaaaatttatattttt |
25630391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32989877 - 32989798
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
32989877 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
32989798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36893895 - 36893974
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36893895 |
tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
36893974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36894504 - 36894425
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36894504 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
36894425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 37747131 - 37747052
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
T |
37747131 |
aacataacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccgaactttaaaatttatattttt |
37747052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40520290 - 40520369
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
40520290 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
40520369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41258048 - 41257969
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
41258048 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
41257969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43284352 - 43284431
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
43284352 |
tgaacatgacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
43284431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43923411 - 43923490
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
43923411 |
tgaacatgacgttttgcaaatatccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
43923490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1650483 - 1650561
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||| ||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
1650483 |
tgaacaagacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
1650561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 101 - 175
Target Start/End: Original strand, 5219910 - 5219984
Alignment:
Q |
101 |
catgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
5219910 |
catgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt |
5219984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 5794716 - 5794794
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| | ||||||||||||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
T |
5794716 |
tgaacatgacgttttgcaaataccacctgaagttttgcacttgtgtgcaaaatgccccccaaacttaaaaatttatatt |
5794794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 14053322 - 14053400
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||| ||||||| |||||||||||| |
|
|
T |
14053322 |
tgaacatgacgttttgcaaataccccatgaagttttgcacttatgtacaaaatgccccccaaacttaaaaatttatatt |
14053400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 20832761 - 20832683
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
20832761 |
aacataacgttttgcaaatatcccctgaagttttgtacttatgtgcaaaataccccataaacttgaaaatttatatttt |
20832683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23916030 - 23916107
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
23916030 |
tgaacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
23916107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26430664 - 26430741
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||| |||||||||||| |
|
|
T |
26430664 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttaagtacaaaatgcccc-caaacttaaaaatttatatt |
26430741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 29100760 - 29100837
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
29100760 |
tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatat |
29100837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 33880616 - 33880538
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
33880616 |
tgaacatgacattttgcaaataccccctgaagttttgctcttatgtgcaaaatgccccccaaacttaaaaatttatatt |
33880538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39407804 - 39407727
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
39407804 |
tgaacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
39407727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 17961073 - 17960993
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
17961073 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
17960993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43433035 - 43433115
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
43433035 |
tgaacatgacgttttgcaaataccccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
43433115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 97 - 176
Target Start/End: Complemental strand, 29101224 - 29101144
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||| |
|
|
T |
29101224 |
tgaacatgacgttttgcaaatactcacctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatattt |
29101144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 37429547 - 37429467
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
37429547 |
atgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
37429467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 41450411 - 41450336
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
T |
41450411 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcc---cgaacttgaaaatttatatttt |
41450336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1651038 - 1650959
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
1651038 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcaccccaaacttaaaaatttatatt |
1650959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 3416802 - 3416881
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||| || | ||||||||||||||||||||| |
|
|
T |
3416802 |
aacatcacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgttccccgaacttgaaaatttatattttt |
3416881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 3454767 - 3454846
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
3454767 |
tgaacatgacgttttgcaaatacccccatgaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttatatt |
3454846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 10825429 - 10825508
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
10825429 |
tgaacatgacgttttacaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
10825508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 11856147 - 11856226
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||||||||| ||||||||||||| ||||||| |||||||||||| |
|
|
T |
11856147 |
tgaacatgacgttttgcaaatatccccctgaaattttgcacttatatgcaaaatgccccccaaacttaaaaatttatatt |
11856226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 14450102 - 14450181
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
14450102 |
tgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
14450181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 15211506 - 15211427
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
15211506 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
15211427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17960463 - 17960542
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||| ||| |||||||| |
|
|
T |
17960463 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgacccccaaacttaaaagtttatatt |
17960542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 21558895 - 21558974
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||| | |||||||||||| |
|
|
T |
21558895 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt |
21558974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31127637 - 31127558
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
31127637 |
tgaacatatcgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
31127558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 33871874 - 33871953
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
33871874 |
tgaacatgacgttttgcaaataaaccccagaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
33871953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39407197 - 39407276
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
39407197 |
tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
39407276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 2657556 - 2657478
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| ||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
2657556 |
tgaacataacgttttgcaaataccccataaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
2657478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 20166668 - 20166590
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
20166668 |
tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
20166590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 38713498 - 38713579
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| | |||||||||||||||| |||| |
|
|
T |
38713498 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttataatttt |
38713579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 26876 - 26796
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
26876 |
aacataacgttttgcaaatatcccccctgaagttttgcacttatgtgcaaaatgtcccctaaacttgaaaatttatatttt |
26796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 3927713 - 3927636
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
3927713 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt |
3927636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 14245010 - 14244930
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
14245010 |
tgaacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
14244930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 35942749 - 35942669
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
35942749 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
35942669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 36468990 - 36469067
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36468990 |
aacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaactttaaaatttatatt |
36469067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39324594 - 39324674
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
39324594 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt |
39324674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 355308 - 355388
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
355308 |
tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttatatt |
355388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 11650882 - 11650965
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||| || ||||||||||||||| |
|
|
T |
11650882 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccccaaaatttaaaaatttatattttt |
11650965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13002129 - 13002049
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaactt-gaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
13002129 |
tgaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaaatttatatt |
13002049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 17925211 - 17925135
Alignment:
Q |
99 |
aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
17925211 |
aacatgacgttttgcaaatacgcccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat |
17925135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 27072586 - 27072503
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||| | ||||||||| ||||||||||| |
|
|
T |
27072586 |
tgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgttcaaaatgtcccccgaacttgaaattttatattttt |
27072503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 36255637 - 36255561
Alignment:
Q |
99 |
aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||||| ||| ||||||| |
|
|
T |
36255637 |
aacatgacgttttgcaaatatcgccctgaagttttgcacttatgtgcaaaatgccccccgaacttaaaattttatat |
36255561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39133248 - 39133168
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccg-caaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
39133248 |
tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccctgccaaacttaaaaatttatatt |
39133168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 40450540 - 40450464
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
40450540 |
aacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat |
40450464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 2656948 - 2657027
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| || |||| |||||||||||| |
|
|
T |
2656948 |
tgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccagacttaaaaatttatatt |
2657027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 5690540 - 5690615
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
5690540 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccttccgaacttaaaaatttatat |
5690615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 5795324 - 5795245
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||| ||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
5795324 |
tgaacatgacgttttgcaaatacccccatgaagttttgcatttatgtgcaaaatgctccccaaacttaaaaatttatatt |
5795245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 25094265 - 25094344
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
T |
25094265 |
aacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatttt |
25094344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 33872967 - 33873045
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
33872967 |
tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
33873045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41257439 - 41257518
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||| |||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
41257439 |
tgaacatgacggtttgcaaatacccccctgaagttttgcacttatgtgcaaaatggcccccaaacttaaaaatttatatt |
41257518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 44308242 - 44308317
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
44308242 |
aacatgacattttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccttgaacttgaaaatttatat |
44308317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 17924634 - 17924716
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| |||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
T |
17924634 |
tgaacatgaagttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatgttttt |
17924716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 23564014 - 23564095
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||| | ||||||||||||||||||||| |
|
|
T |
23564014 |
aacatcacgttttgcaaatatcctccctgaagttttgcacttcagtgcaaaatgccccccgaacttgaaaatttatattttt |
23564095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 98 - 160
Target Start/End: Complemental strand, 33872754 - 33872692
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaac |
160 |
Q |
|
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||| |
|
|
T |
33872754 |
gaacatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaac |
33872692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 38713882 - 38713965
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| | |||||||||||||||| |||| |
|
|
T |
38713882 |
tgaacatgacgttttgcaaatacccccccctgaagttttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttataatttt |
38713965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 38714773 - 38714692
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| |||| |||||||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
T |
38714773 |
aacatgacgttttgcaaataccccccctgaaattttgcacttatgtgcaaaatgcctcccgaacttgaaaatttatattttt |
38714692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 3177933 - 3177998
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
3177933 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
3177998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 10308567 - 10308488
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
10308567 |
tgaatatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
10308488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 11651426 - 11651342
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc------tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
11651426 |
tgaacatgacgttttgcaaataccccccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
11651342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 12764236 - 12764301
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
12764236 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
12764301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 26431542 - 26431462
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||| ||| ||||||| |||||||||||| |
|
|
T |
26431542 |
tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgtaaaatgtcccacaaacttaaaaatttatatt |
26431462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 31917939 - 31918019
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||| ||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
31917939 |
tgaacatgacgttttgcaaataccccccctgaagttttgcatttatgtgcaaaatgctccccaaacttaaaaatttatatt |
31918019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 6653892 - 6653812
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||||| |||| ||||||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
T |
6653892 |
aacatgacgttttgcaaatatccccctgaatttttgcacttacgtgcaaaatgccttccgaacttgaaaatttatattttt |
6653812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 6734292 - 6734212
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||||| |||| ||||||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
T |
6734292 |
aacatgacgttttgcaaatatccccctgaatttttgcacttacgtgcaaaatgccttccgaacttgaaaatttatattttt |
6734212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 9114801 - 9114877
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata |
173 |
Q |
|
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||| || ||||||| |||||||||| |
|
|
T |
9114801 |
gaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcctccaaacttaaaaatttata |
9114877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 98 - 171
Target Start/End: Original strand, 9736243 - 9736318
Alignment:
Q |
98 |
gaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||| || |||||||| |
|
|
T |
9736243 |
gaacatgacgttttgcaaatattccccctgaagttttgcacttatgtgcaaactgccccccaaatttaaaaattta |
9736318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 172
Target Start/End: Original strand, 10307836 - 10307912
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
T |
10307836 |
tgaacattacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttat |
10307912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 11178854 - 11178913
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
11178854 |
tgaacatgacgttttgcaaatacatcccctgaagttttgcacttatgtgcaaaatgcccc |
11178913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 7482772 - 7482697
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||| | || |||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
T |
7482772 |
aacatgacgttttgcaaataccccataaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatat |
7482697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13001522 - 13001600
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| | |||||||||||||||| ||||||||||||| ||||||| |||||||||||| |
|
|
T |
13001522 |
tgaacatgacgttttgcaaataccccgttgaagttttgcacttatatgcaaaatgcccc-caaacttaaaaatttatatt |
13001600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 15730634 - 15730689
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
15730634 |
aacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc |
15730689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 17733882 - 17733827
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
T |
17733882 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatacccc |
17733827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 32989269 - 32989348
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| ||| | |||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
32989269 |
tgaacatgacgttttgtaaacacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
32989348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39132868 - 39132947
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| ||| | |||||||||||||||||||||||||||||| ||| ||| |||||||||||| |
|
|
T |
39132868 |
tgaacatgacattttgcaaatacccctccgaagttttgcacttatgtgcaaaatgccccccaatcttaaaaatttatatt |
39132947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39325168 - 39325096
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
39325168 |
tgaacatgacgttttgcaaata------gaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
39325096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 44445528 - 44445449
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||| |
|
|
T |
44445528 |
tgaacatgaagttttgcaaatgctcccctgaagttttacacttatgtgcaaaatgtccccgcaaacttaaaaatttatat |
44445449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 9879219 - 9879142
Alignment:
Q |
99 |
aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
T |
9879219 |
aacatgacgttttgcaaatacctcccatgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatat |
9879142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 15602030 - 15601954
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
15602030 |
aacatgacgttttgcaaataccctacctgaagttttgcacttatgtgcaaaatgcccc-ccaacttaaaaatttatat |
15601954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31918544 - 31918467
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| | |||||||||||| ||||||||||||| ||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
31918544 |
tgaacattatgttttgcaaataacccctgaagttttacacttatgtgcaaaatgcctc-caaacttaaaaatttatatt |
31918467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 37428668 - 37428745
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||||||||||||||| ||||| || |||||||||||||||||||||| |||| ||||||| ||||||||||||| |
|
|
T |
37428668 |
aacatgacgttttgcaaatacccccttaaagttttgcacttatgtgcaaaat-ccccccaaacttaaaaatttatattt |
37428745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 101 - 154
Target Start/End: Complemental strand, 39864170 - 39864116
Alignment:
Q |
101 |
catgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
39864170 |
catgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgcccc |
39864116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 12383208 - 12383288
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||| ||||||| | | ||||||| |||||||||||| |
|
|
T |
12383208 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgttcaaaatgactcccaaacttaaaaatttatatt |
12383288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 27071711 - 27071792
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| |||||||||||||| |||||||| || ||||||||||| ||||||||||| ||||| ||||||||||||||| |
|
|
T |
27071711 |
tgaacataacgttttgcaaataccccctgaaattgtgcacttatgttcaaaatgccccttgaacttaaaaatttatattttt |
27071792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 159
Target Start/End: Complemental strand, 28776745 - 28776681
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaa |
159 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| |
|
|
T |
28776745 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaa |
28776681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 41450066 - 41450139
Alignment:
Q |
102 |
atgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||| |||| ||||||||||||||||||| |||||||||| | ||||||||||||||||| |
|
|
T |
41450066 |
atgacgttttgcaaatacccccatgaagttttgcacttatgtacaaaatgccctccgaacttgaaaatttatat |
41450139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 43085704 - 43085624
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||| |||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
43085704 |
tgaacatgatattttacaaatacctcccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt |
43085624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 168
Target Start/End: Original strand, 3926005 - 3926077
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaat |
168 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||| || ||||||| ||||| |
|
|
T |
3926005 |
tgaacatgacgttttgcaaataccccgctgaagttttgcacttatgtgcaaaatgttcctcaaacttaaaaat |
3926077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 152
Target Start/End: Complemental strand, 10831293 - 10831237
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcc |
152 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
T |
10831293 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcc |
10831237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 20166085 - 20166163
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||| | |||||||| |||||||| |
|
|
T |
20166085 |
aacatgacgttttgcaaatatccccccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaagatttatat |
20166163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 171
Target Start/End: Original strand, 23564795 - 23564867
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
||||| |||||||| ||||| | |||||||||||||||||||||||||||||| || | |||||||||||||| |
|
|
T |
23564795 |
aacatcacgttttgtaaatacctcctgaagttttgcacttatgtgcaaaatgcaccccgaacttgaaaattta |
23564867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 28776135 - 28776211
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
28776135 |
tgaacatgacgtt--gcaaatacccctctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
28776211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1077927 - 1077849
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| || |||||||||||||||||||||||||||||||| ||||||| |||| ||||||| |
|
|
T |
1077927 |
tgaacatgacattttgcaaatacccgtctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaaattatatt |
1077849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 5691466 - 5691387
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||| ||||| |||||||||||||||||||| ||||||||||| | ||||||||||||||||| |||| |
|
|
T |
5691466 |
aacatcacgttttgtaaataccccctgaagttttgcacttacatgcaaaatgccgctgaaacttgaaaatttataatttt |
5691387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36507885 - 36507963
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| |||| ||| |||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
36507885 |
tgaacatgacgttttacaaatacccccctgaggttttgcacttatgtgcaaaatacccc-caaacttaaaaatttatatt |
36507963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 179
Target Start/End: Complemental strand, 36573628 - 36573546
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttg |
179 |
Q |
|
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||| || ||||| |||||||||| ||||| |
|
|
T |
36573628 |
aacatgacgttttgcaaataacctccctgaagttttgcacttatgtgcaaaatgctcctttaacttaaaaatttataattttg |
36573546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 151
Target Start/End: Complemental strand, 11179950 - 11179896
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc |
151 |
Q |
|
|
||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
11179950 |
tgaacatgatattttgcaaataccccctgaagttttgcacttatgtgcaaaatgc |
11179896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 31204030 - 31204087
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
31204030 |
cccctgaaattttgcacttatgtgcaaaatgcccc-taaacttgaaaatttatattttt |
31204087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 33852911 - 33852854
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
T |
33852911 |
cccctgaagttttgcacttatgtgcaaaatgccac-cgaacttgaaaatttatattttt |
33852854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 41392689 - 41392747
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
41392689 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaatttgaaaatttatattttt |
41392747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 42994489 - 42994431
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
42994489 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaatttgaaaatttatattttt |
42994431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 44444944 - 44445021
Alignment:
Q |
99 |
aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| ||||||||| ||||||||||| | || |||||||||||||| |
|
|
T |
44444944 |
aacacgacgttttgcaaatacctcccctgaagttttacacttatgtacaaaatgccccccgaatttgaaaatttatat |
44445021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 44671967 - 44671909
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
T |
44671967 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttagattttt |
44671909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 35942164 - 35942217
Alignment:
Q |
122 |
cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
35942164 |
cctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt |
35942217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 25953 - 26029
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||| |||||| || ||| |||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
25953 |
aacatgacgttttacaaatactctcctaaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttatat |
26029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 3419007 - 3418926
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||| | ||||| ||||||||||||||| |
|
|
T |
3419007 |
aacatgacgttttgcaaatacccctccatgaagttttgcacttatgtccaaaatgcccc-cgaacttaaaaatttatattttt |
3418926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 12503138 - 12503058
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
T |
12503138 |
aacatgacgttttgcaaatacacccttgaagttttgcacttatgtgtaaaatgcatcctgaacttgaaaatttatattttt |
12503058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 15565576 - 15565500
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||| |||||||||||||||| ||| ||||| ||||||||||| |
|
|
T |
15565576 |
aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgtcccctcaacttaaaaatttatat |
15565500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 25631220 - 25631140
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| ||||||||||| ||| | ||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
25631220 |
aacatgaaattttgcaaataccccgttgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaatttatattttt |
25631140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 31819852 - 31819908
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| ||||| || ||||||||||||||||||||||||||| |
|
|
T |
31819852 |
aacatgacgttttgcaaatacccccttaaagttttgcacttatgtgcaaaatgcccc |
31819908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 37746433 - 37746485
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
T |
37746433 |
aacatgacgttttgcaaatatctccatgaagttttgcacttatgtgcaaaatg |
37746485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 40449961 - 40450040
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||| |||| |||||||||||| |||| ||||||| ||||||||||||||||||||||| ||||||| |||| |||||| |
|
|
T |
40449961 |
tgaatatgaagttttgcaaataccccccctgaagttgtgcacttatgtgcaaaatgccccccaaacttaaaaacttatat |
40450040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 41543206 - 41543150
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||| ||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
T |
41543206 |
cccctgaaattttgcacttatgtgcagaatgccccctaaacttgaaaatttatattt |
41543150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 32449087 - 32449161
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| | | ||||||||||||||||||||||||||| | ||||||| ||||||||||| |
|
|
T |
32449087 |
aacatgacgttttgcaaataccatataaagttttgcacttatgtgcaaaatgcctc-caaacttaaaaatttatat |
32449161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 39863484 - 39863558
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| |||||||||||| ||||||| |||||||||||| | | ||||| ||||||||||| |
|
|
T |
39863484 |
aacataacgttttgcaaataccccctgaagtttcgcactta-gtgcaaaatgcctcccgaactttaaaatttatat |
39863558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 162
Target Start/End: Complemental strand, 43284922 - 43284858
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaactt |
162 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||| |
|
|
T |
43284922 |
tgaacatgacgttttgcaaatacccccctgaagttttgca--tatgtgcaaaatgcccctcaaactt |
43284858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 30729061 - 30729007
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
30729061 |
tgaaattttgcacttatgtgcaaaatgcccactaaacttgaaaatttatattttt |
30729007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 132 - 178
Target Start/End: Original strand, 41575089 - 41575135
Alignment:
Q |
132 |
tgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
41575089 |
tgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
41575135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 41576688 - 41576630
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
41576688 |
cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt |
41576630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 44869079 - 44869022
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
44869079 |
cccctgaaattttgcacttatgtgcaaaatgcccc-taaacttaaaaatttatattttt |
44869022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 99 - 152
Target Start/End: Original strand, 15564658 - 15564711
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcc |
152 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||||||||||| |||||||||| |
|
|
T |
15564658 |
aacataacgttttgcaaataccccccgaagttttgcacttatgagcaaaatgcc |
15564711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 36740084 - 36740027
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||| ||||||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
T |
36740084 |
tgaatatgacgttttgcaaataccctatgaagttttgcacttatatgcaaaatgcccc |
36740027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 42356196 - 42356131
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| ||| || |||||||| |||||| |
|
|
T |
42356196 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaatttaaaaatttagattttt |
42356131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 4488796 - 4488740
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||| |||||||||||||||||||| ||||| ||| |||||||||||||||| |
|
|
T |
4488796 |
cccctgaaattttgcacttatgtgcaaaacgccccctaaatttgaaaatttatattt |
4488740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 17732984 - 17733060
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||||||||| || ||| |||||||| ||||||||||||||| |||| |||||| ||||||||||| |
|
|
T |
17732984 |
aacatgacattttgcaaatactcacctaaagttttgtacttatgtgcaaaataccccttaaacttaaaaatttatat |
17733060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 1143951 - 1143892
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaac-ttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||| || ||||||||||||||| |
|
|
T |
1143951 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaactttaaaaatttatattttt |
1143892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 12502229 - 12502304
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| || |||||||||||||| |||||||||||||| || ||||||||||||||||||| |
|
|
T |
12502229 |
aacatgacgttttgcaaatacccaccctgaagttttgcatttatgtgcaaaatgtcc------cttgaaaatttatattttt |
12502304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 171
Target Start/End: Complemental strand, 12765033 - 12764982
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |
|
|
T |
12765033 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
12764982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 31204576 - 31204521
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
31204576 |
ctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
31204521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 34056020 - 34055965
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
34056020 |
ctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt |
34055965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 178
Target Start/End: Original strand, 44629075 - 44629146
Alignment:
Q |
108 |
ttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||| || | |||||||||||||||||||||| |||||| | ||||||||||||||||||||| |
|
|
T |
44629075 |
ttttgcaaataccctcatgaagttttgcacttatgtgcataatgccattcgaacttgaaaatttatattttt |
44629146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 3178485 - 3178427
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||| ||||||||||||| |||||| |||||||| |||||| |
|
|
T |
3178485 |
cccctgaaattttgcacttatctgcaaaatgccccttaaacttaaaaatttagattttt |
3178427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 4484689 - 4484747
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||| |||||||||||||| |||||| |||||||| |||||| |
|
|
T |
4484689 |
cccctgaaattttgcacttaagtgcaaaatgccccctaaacttaaaaatttagattttt |
4484747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 30728243 - 30728301
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||| ||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
30728243 |
cccctgaaattttacacttatgtgcaaaatgccccttaaacttaaaaatttagattttt |
30728301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 150
Target Start/End: Complemental strand, 35772476 - 35772422
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
|||||||||| ||||||||||| | |||| ||||||||||||||||||||||||| |
|
|
T |
35772476 |
tgaacatgacattttgcaaataccgcccttaagttttgcacttatgtgcaaaatg |
35772422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 36251952 - 36252029
Alignment:
Q |
99 |
aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| || ||||||||| ||||||||| |||||||||||||||||||||| | | |||||| ||||||||||| |
|
|
T |
36251952 |
aacatgatgtattgcaaatacctcccctgaaattttgcacttatgtgcaaaatgtctcctaaacttaaaaatttatat |
36252029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 37262455 - 37262397
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||| |||||| |||||||| |||||| |
|
|
T |
37262455 |
cccctgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaatttagattttt |
37262397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 39584540 - 39584482
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| || |||||||||||||||| ||||| ||| |||||||||||||||||||||| |
|
|
T |
39584540 |
cccctaaaattttgcacttatgtgctaaatgtcccctaaacttgaaaatttatattttt |
39584482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 41393512 - 41393454
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||| ||||||||||| |||||| |||||||| |||||| |
|
|
T |
41393512 |
cccctgaaattttgcacttatgtataaaatgccccgtaaacttaaaaatttagattttt |
41393454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 44671145 - 44671203
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| || || ||||||||||||||| |
|
|
T |
44671145 |
cccctgaaattttgcacttatgtgcaaaatgcccctaaactttaaaaatttatattttt |
44671203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 150
Target Start/End: Complemental strand, 27575976 - 27575927
Alignment:
Q |
102 |
atgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
||||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
T |
27575976 |
atgacgttttgcaaatacccctctgaagttttacacttatgtgcaaaatg |
27575927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 29732721 - 29732645
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| ||| |||| |||| ||||||| |||||||| || | ||||||||||||||||| |
|
|
T |
29732721 |
tgaacatgacgttttgcaaataccccttgaaattttacacttatatgcaaaatacctc-tgaacttgaaaatttatat |
29732645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 174
Target Start/End: Complemental strand, 31820532 - 31820464
Alignment:
Q |
107 |
gttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||| ||| |||||||||| ||||||||||||||||| ||| ||||| ||||||||||| |
|
|
T |
31820532 |
gttttgcaaatacccctctgaagttttccacttatgtgcaaaatgtcccctgaactttaaaatttatat |
31820464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 6869112 - 6869162
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
||||||||||||| ||||||| ||||||||||||||||||||| ||||||| |
|
|
T |
6869112 |
aacatgacgtttt-caaatatttcctgaagttttgcacttatgttcaaaatg |
6869162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 164
Target Start/End: Original strand, 33851613 - 33851656
Alignment:
Q |
121 |
ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga |
164 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| | ||||||| |
|
|
T |
33851613 |
ccctaaagttttgcacttatgtgcaaaatgccccccgaacttga |
33851656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 171
Target Start/End: Original strand, 44868533 - 44868584
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
|||||||| |||||||||||| ||||||||||||| |||||| |||||||| |
|
|
T |
44868533 |
cccctgaaattttgcacttatatgcaaaatgccccctaaacttaaaaattta |
44868584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 128 - 178
Target Start/End: Complemental strand, 9263887 - 9263837
Alignment:
Q |
128 |
gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
9263887 |
gttttgcacttatgtgcaaaatgctctttgaacttgaaaatttatattttt |
9263837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 124 - 170
Target Start/End: Original strand, 25617011 - 25617057
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
|||| |||||||||||||||||||||||||| |||||| ||||||| |
|
|
T |
25617011 |
tgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattt |
25617057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 154
Target Start/End: Original strand, 38256560 - 38256594
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |
|
|
T |
38256560 |
cccctgaaattttgcacttatgtgcaaaatgcccc |
38256594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 39583769 - 39583819
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
|||||||| ||||||||||||||||||||| |||| |||||| ||||||| |
|
|
T |
39583769 |
cccctgaaattttgcacttatgtgcaaaataccccataaacttaaaaattt |
39583819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 121 - 174
Target Start/End: Complemental strand, 15633319 - 15633266
Alignment:
Q |
121 |
ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||| |||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
15633319 |
ccctgaaattttatacttatgtgcaaaatgcccccccaacttaaaaatttatat |
15633266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 165
Target Start/End: Original strand, 37261909 - 37261954
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaa |
165 |
Q |
|
|
|||||||| ||||||||||| |||||||||||||| ||||||||| |
|
|
T |
37261909 |
cccctgaaattttgcacttacgtgcaaaatgccccctaaacttgaa |
37261954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 177
Target Start/End: Complemental strand, 38257094 - 38257037
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
|||||||| |||||||||||||||||||||||| | |||||| ||| |||| ||||| |
|
|
T |
38257094 |
cccctgaaattttgcacttatgtgcaaaatgcctcctaaacttaaaattttagatttt |
38257037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 6870042 - 6869990
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
|||||||| |||||||||||||||| | ||||||| |||||||||||||||| |
|
|
T |
6870042 |
aacatgacattttgcaaatatccccttaaagtttttgacttatgtgcaaaatg |
6869990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 128 - 172
Target Start/End: Complemental strand, 32449415 - 32449371
Alignment:
Q |
128 |
gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
|||||||||||||||||||||| ||| ||||||| ||||||||| |
|
|
T |
32449415 |
gttttgcacttatgtgcaaaataccctccaaacttaaaaatttat |
32449371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 68; Significance: 4e-30; HSPs: 239)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 26537742 - 26537663
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
T |
26537742 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccctcgaacttaaaaatttatattttt |
26537663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17273050 - 17273128
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
17273050 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
17273128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31196767 - 31196689
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
31196767 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
31196689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 31434764 - 31434842
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
31434764 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
31434842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32832394 - 32832316
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
32832394 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt |
32832316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37587742 - 37587664
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
37587742 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt |
37587664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 47433653 - 47433730
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
47433653 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
47433730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 3898403 - 3898324
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
3898403 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
3898324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 11992730 - 11992651
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
11992730 |
atgaacatgacgttttgcaaataccccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
11992651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 16265461 - 16265540
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
16265461 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
16265540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30751262 - 30751341
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
30751262 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
30751341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30753073 - 30753152
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
30753073 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
30753152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 51619543 - 51619622
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
51619543 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
51619622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 17273660 - 17273582
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
17273660 |
tgaacatgacgttttgcaaataccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
17273582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 22775573 - 22775651
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
22775573 |
tgaacatgacgttttacaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt |
22775651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31676385 - 31676307
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||| |
|
|
T |
31676385 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaacgccccccaaacttaaaaatttatatt |
31676307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36304144 - 36304222
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36304144 |
tgaacatgacgttttgcaaatatcctttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
36304222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42246898 - 42246820
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
42246898 |
tgaacatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
42246820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 48803498 - 48803576
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
48803498 |
tgaacatgaagttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgccccccaaacttgaaaatttatat |
48803576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 51000991 - 51000913
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
51000991 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaacttcaaaatttatatt |
51000913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 18053824 - 18053904
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
18053824 |
tgaacatgacgttttgcaaatacttcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
18053904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 16797272 - 16797351
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
16797272 |
aacatgacgttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgcccc-taaacttgaaaatttatattttt |
16797351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 35156127 - 35156051
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
35156127 |
aacatgacgttttgcaaatatccccatgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttatat |
35156051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7436679 - 7436758
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
7436679 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
7436758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7437286 - 7437207
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
7437286 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
7437207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 10386971 - 10387050
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
10386971 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
10387050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 11992121 - 11992200
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
11992121 |
tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
11992200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13242329 - 13242408
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
13242329 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
13242408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24982779 - 24982858
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
24982779 |
tgaacatgacgttttgcaaatattcccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
24982858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25227539 - 25227618
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
25227539 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
25227618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26442033 - 26442112
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
26442033 |
tgaacatgacgttttgcaaatatccccctgaagtttttcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
26442112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32074663 - 32074584
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||| |||||| |
|
|
T |
32074663 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatatatatt |
32074584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 35894200 - 35894279
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
35894200 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
35894279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 35894809 - 35894730
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
35894809 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
35894730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37538467 - 37538388
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
37538467 |
tgaacatgacgttttgcaaatatccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
37538388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37613574 - 37613495
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
37613574 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
37613495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 46804505 - 46804426
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
46804505 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
46804426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 52869795 - 52869870
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
52869795 |
aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat |
52869870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4512737 - 4512814
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| | |||||||||||| |
|
|
T |
4512737 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacataaaaatttatatt |
4512814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 14403971 - 14404049
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
T |
14403971 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccg--aactt-aaaatttatattttt |
14404049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 29674430 - 29674508
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||| ||||||| |||||||||||| |
|
|
T |
29674430 |
tgaacatgacgttttgcaaataccccatgaagttttgcacttatgtacaaaatgccccccaaacttaaaaatttatatt |
29674508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 37612966 - 37613044
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
37612966 |
tgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatat |
37613044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 48803897 - 48803819
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
48803897 |
tgaacatgaagttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
48803819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 52359426 - 52359503
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
52359426 |
tgaacatgacgttttgcaaataccccctgaagttttccacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
52359503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4469589 - 4469669
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
4469589 |
tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
4469669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 6783843 - 6783766
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| ||||||||||| |
|
|
T |
6783843 |
tgaacatgaagttttgcaaataccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaatttatat |
6783766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8384098 - 8384018
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
8384098 |
tgaacatgacgttttgcaaataccccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
8384018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 9061173 - 9061093
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
9061173 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
9061093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 29329425 - 29329506
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| |||||||||||| ||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
T |
29329425 |
tgaacatgatgttttgcaaataccccctgaagttttgcacttatatgcaaaatgccctccaaacttaaaaatttatattttt |
29329506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 29358356 - 29358276
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
29358356 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
29358276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37276329 - 37276249
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
37276329 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
37276249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38788549 - 38788469
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
38788549 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
38788469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43680499 - 43680576
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
43680499 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaact--aaaatttatatt |
43680576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 1799753 - 1799678
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
1799753 |
aacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttatat |
1799678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4632385 - 4632306
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
4632385 |
tgaacatgactttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
4632306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 10387580 - 10387501
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||| | |||||||||||| |
|
|
T |
10387580 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt |
10387501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 20898649 - 20898728
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
20898649 |
tgaacatgacattttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
20898728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 25228149 - 25228070
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
25228149 |
tgaacatgacgttttgcaaatacccccctgaagctttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
25228070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 25859579 - 25859500
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
25859579 |
tgaacatgacgttttacaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaacttacaaatttatatt |
25859500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 26615067 - 26615142
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | || |||||| ||||||| |
|
|
T |
26615067 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccgaatttgaaattttatat |
26615142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 29330031 - 29329953
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
29330031 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
29329953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 37275719 - 37275798
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
37275719 |
tgaacacgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
37275798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38456708 - 38456787
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
38456708 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgacctccaaacttaaaaatttatatt |
38456787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 40315546 - 40315467
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||| |||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
40315546 |
aacatgacgttttgcaaataccccgtgaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttatattttt |
40315467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41115782 - 41115703
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
41115782 |
tgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
41115703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 96 - 175
Target Start/End: Original strand, 42246300 - 42246378
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
42246300 |
atgaacatgacgttttgcaaataccccc-gaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
42246378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 46294574 - 46294653
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
46294574 |
aacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatttt |
46294653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 46803897 - 46803976
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||| ||||||| |
|
|
T |
46803897 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaacttatatt |
46803976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 47434260 - 47434181
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
47434260 |
tgaacatgacgttttgcaaatacccccctgaacttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
47434181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 51000102 - 51000178
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
51000102 |
tgaacatgacgttttgtaaataccccctgaagttttgcacttatgtgcaaaatgccc--caaacttaaaaatttatatt |
51000178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13265338 - 13265261
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||| | |||||||||||| |
|
|
T |
13265338 |
tgaacatgacgttttgcaaataccccc-gaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt |
13265261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 18611865 - 18611787
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||| ||||||||||| |
|
|
T |
18611865 |
tgaacatgaagttttgcaaatatccccctgaagttttgcacttatgtacaaaatgcccctcaaacttaaaaatttatat |
18611787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 24250543 - 24250621
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
24250543 |
tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
24250621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 43214607 - 43214688
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
T |
43214607 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatattttt |
43214688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 4514114 - 4514033
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
4514114 |
atgaacatgacgttttgcaaatatccccctgaaattttgcacttatgtgcaaaatgtccccccaaacttaaaaatttatatt |
4514033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 31196159 - 31196239
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||| | |||||||||||| |
|
|
T |
31196159 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt |
31196239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 31675518 - 31675598
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
31675518 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
31675598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38457318 - 38457238
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
38457318 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
38457238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38787667 - 38787747
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
38787667 |
tgaacatgacgttttgcaaacaccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
38787747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 45508024 - 45508103
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
45508024 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
45508103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 49204205 - 49204125
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
49204205 |
tgaacatgacgttttgcaaataccccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
49204125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 6783263 - 6783339
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
6783263 |
aacatgacgttttgcaaatactcctctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat |
6783339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 32815043 - 32814963
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| ||||| |||||| |||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
32815043 |
aacatgatgtttttcaaatacccccatgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttatattttt |
32814963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 43760247 - 43760167
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||| |||||| |||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
43760247 |
aacatgacgtttttcaaatacccccctgaagttttgcgcttatgtgcaaaatgccctccaaacttgaaaatttatattttt |
43760167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 45141605 - 45141685
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaactt-gaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
T |
45141605 |
aacatgacgttttgcaaataccccctggagttttgcacttatgtgcaaaatgccccctgaacttggaaaatttatattttt |
45141685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1024173 - 1024094
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| |||||| |||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
1024173 |
tgaacatgacgttttacaaatactcccctaaagttttgcacttatgtgcaaaattccccccaaacttaaaaatttatatt |
1024094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4470199 - 4470120
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
4470199 |
tgaacatgacgttttgcaaatacccccataaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttatatt |
4470120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13242955 - 13242876
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| |||| |||||||||| |||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
13242955 |
tgaacataacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
13242876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 13534054 - 13533999
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
13534054 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc |
13533999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 20899257 - 20899179
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
20899257 |
tgaacatgacgttttgcaaatacccccctgaagttctgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
20899179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 25376867 - 25376946
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||| |||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
25376867 |
aacatcacgttttgcaaataccccctgaagttttgcaattatgtgcaaaatgcctcttgaacttgaaaatttatattttt |
25376946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 161
Target Start/End: Original strand, 29357491 - 29357557
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaact |
161 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
29357491 |
tgaacatgacgttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgccccccaaact |
29357557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 96 - 175
Target Start/End: Original strand, 30634429 - 30634507
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| || | ||||| |||||||||||| |
|
|
T |
30634429 |
atgaacatgacgttttgtaaataccccctgaagttttgcacttatgtgcaaaatgctcc-cgaacttaaaaatttatatt |
30634507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31435479 - 31435400
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| || |||||| |||||||||||| |
|
|
T |
31435479 |
tgaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgctcccaaaacttaaaaatttatatt |
31435400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 32831784 - 32831862
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| | |||||||||| |
|
|
T |
32831784 |
tgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgccccccaaactt-agaatttatatt |
32831862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 37587133 - 37587212
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | |||| || |||||||||||| |
|
|
T |
37587133 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaatttaaaaatttatatt |
37587212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38834248 - 38834170
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||| |||||| |||||||||||| |
|
|
T |
38834248 |
tgaacatgacgttttgcaaataccccactgaagttttgcacatatgtgcaaaatgccccg-aaacttaaaaatttatatt |
38834170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42148507 - 42148585
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
42148507 |
tgaacataacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
42148585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 44431319 - 44431398
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
44431319 |
aacatgacgttttgcaaatactccctgaagttttgtacttatgtgcaaaataccccatgaacttgaaaatttatattttt |
44431398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 1798900 - 1798978
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| ||| |||||||||||||||||||||||||| |||| ||| ||||||||||||||||| |
|
|
T |
1798900 |
aacataacgttttgcaaataccccatgaagttttgcacttatgtgcaaaataccccataaatttgaaaatttatatttt |
1798978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 172
Target Start/End: Original strand, 8897054 - 8897128
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
T |
8897054 |
aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttat |
8897128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 12770200 - 12770278
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| ||||||||||| |
|
|
T |
12770200 |
tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatat |
12770278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 22776140 - 22776063
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || || ||||||||| ||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
22776140 |
tgaacatgacgttttgcaaatacccactaaagttttgctcttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
22776063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 27234368 - 27234445
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata |
173 |
Q |
|
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
T |
27234368 |
gaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
27234445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 29675039 - 29674958
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
29675039 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttatatt |
29674958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 98 - 173
Target Start/End: Complemental strand, 36305027 - 36304950
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatccc--ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata |
173 |
Q |
|
|
||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
T |
36305027 |
gaacatgacgttttgcatatatccctcctgaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttata |
36304950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 44432238 - 44432160
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| ||| | |||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
T |
44432238 |
aacataacgttttgcaaataccccataaagttttgcacttatgtgaaaaatgccccctaaacttgaaaatttatatttt |
44432160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 48720904 - 48720981
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||| | ||||||||||||||||| |
|
|
T |
48720904 |
aacatgacgttttgcaaatatccgccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaaaatttatat |
48720981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 52870043 - 52870120
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
52870043 |
tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatat |
52870120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13149627 - 13149707
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc--ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
13149627 |
tgaatatgacgttttgcaaatacccctcctgaagttttgcacttatgtgcaaaatgcgcctcaaacttaaaaatttatatt |
13149707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 16266560 - 16266639
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| |||| |||||||||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
T |
16266560 |
tgaacatgacgttttgcaaatatccccccagaagttttgcacttgtgtgcaaaatgcccc-caaacttaaaaatttatatt |
16266639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 18054435 - 18054355
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| |||||||||| |||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
18054435 |
tgaacatgatgttttgcaaataccccccctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
18054355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 99 - 172
Target Start/End: Original strand, 18611286 - 18611359
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||| | ||| | ||||||||||||||| |
|
|
T |
18611286 |
aacatgacgttttgcaaatatcccctgaagttttacacttatgtgcaaattcccctccgaacttgaaaatttat |
18611359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 99 - 164
Target Start/End: Original strand, 27234556 - 27234621
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga |
164 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||| |
|
|
T |
27234556 |
aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgctccctaaacttga |
27234621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 52360290 - 52360210
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
52360290 |
tgaacatgacgttttgaaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
52360210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 16798212 - 16798132
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||| ||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
16798212 |
aacatgacgttttgcaaatacccccctgaagtttttcacttatgtgcaaaatgtccccagaacttgaaaatttatattttt |
16798132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 23703797 - 23703721
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
23703797 |
aacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcctcctgaacttgaaaatttatat |
23703721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 98 - 173
Target Start/End: Complemental strand, 30753953 - 30753878
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata |
173 |
Q |
|
|
||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||| ||||||| |||||||||| |
|
|
T |
30753953 |
gaacatgacgttttgcaaatacccgcctgaagttttgcacttatgtgcaaaaggcccc-caaacttaaaaatttata |
30753878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 37812488 - 37812568
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaag-ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||| || |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
37812488 |
tgaacatgacgttttgcaaatactccccttaaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
37812568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4212921 - 4212999
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||| ||||||| |
|
|
T |
4212921 |
tgaacatgatgttttgcaaatatcccccagaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaaattatatt |
4212999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8383486 - 8383567
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
8383486 |
tgaacatgacgttttgcaaatacccccccctgaagttttgcacttatgtgcaaaatgtcctccaaacttcaaaatttatatt |
8383567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37813098 - 37813020
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||| ||||||||| ||||||| |||||||||||| |
|
|
T |
37813098 |
tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgc-aaatgccccccaaacttaaaaatttatatt |
37813020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38617919 - 38617840
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
38617919 |
tgaacatgatgttttgcaaatacaccccagaagttttgcacttatgtgcaaaattcccctcaaacttaaaaatttatatt |
38617840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 42233603 - 42233528
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| | | ||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
42233603 |
aacatgacgttttgcaaatacctcatgaagttttgcacttatgtgcaaaatgccacctgaacttgaaaatttatat |
42233528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 44396599 - 44396677
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
44396599 |
tgaacatgacgttttacaaatacccccttgaagttttgcacttatgtgcaaaatgcccc-caaactaaaaaatttatatt |
44396677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 48721479 - 48721400
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgcccc-gcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
48721479 |
tgaacatgaagttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgcccctccaaacttaaaaatttatat |
48721400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6917277 - 6917355
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||| |||||||||||||||| | | ||||| |||||||||||| |
|
|
T |
6917277 |
tgaacatgacgttttgcaaatactccctaaagttttgcatttatgtgcaaaatgcctcacgaacttaaaaatttatatt |
6917355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 9033724 - 9033782
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
9033724 |
cccctgaaattttgcacttatgtgcaaaatgccccttaaacttgaaaatttatattttt |
9033782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 153
Target Start/End: Complemental strand, 11202172 - 11202118
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccc |
153 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
T |
11202172 |
aacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccc |
11202118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 11707441 - 11707383
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
11707441 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
11707383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 100 - 175
Target Start/End: Original strand, 20358061 - 20358138
Alignment:
Q |
100 |
acatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
20358061 |
acatgatgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt |
20358138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 100 - 175
Target Start/End: Complemental strand, 20561894 - 20561817
Alignment:
Q |
100 |
acatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
20561894 |
acatgatgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt |
20561817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 28296684 - 28296766
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| ||||| |||||| |||| |||||||||||||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
T |
28296684 |
tgaacatgaagttttacaaatacccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatgttttt |
28296766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 36723984 - 36723926
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
36723984 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
36723926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 38623780 - 38623722
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
38623780 |
cccctgaaattttgcacttatgtgcaaaatgccccttaaacttgaaaatttatattttt |
38623722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 107 - 174
Target Start/End: Complemental strand, 40116910 - 40116841
Alignment:
Q |
107 |
gttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||| ||| | ||||||||||||||||| |
|
|
T |
40116910 |
gttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgtccctcgaacttgaaaatttatat |
40116841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 170
Target Start/End: Complemental strand, 44397478 - 44397404
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
T |
44397478 |
tgaacataacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaattt |
44397404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 45508632 - 45508550
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaat-gccccgc-aaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||| | |||||| |||||||||||| |
|
|
T |
45508632 |
atgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatcgccccccaaaacttaaaaatttatatt |
45508550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 49203330 - 49203408
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| ||||||||||||||| |||| |||||||||| ||||||||||||| |||||| ||||||| |||||||||||| |
|
|
T |
49203330 |
gaacaagacgttttgcaaataaccccctgaagttttgtacttatgtgcaaattgccccccaaacttaaaaatttatatt |
49203408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 11184543 - 11184623
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||||||||||||||||| || |||||||||||||||||| ||||||||| ||| | | ||||||||||||||||||| |
|
|
T |
11184543 |
tgaatatgacgttttgcaaatacccactgaagttttgcacttatatgcaaaatgtccc-cgagcttgaaaatttatattttt |
11184623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 16834500 - 16834577
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| ||||||||||| || |||| | ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
16834500 |
aacataacgttttgcaattaccccccttaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatt |
16834577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38833638 - 38833718
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||| |||||||||||||| |||||||||| |||||| |||||||||||| |
|
|
T |
38833638 |
tgaacatgacgttttgcaaataccccccctgaagatttgcacttatgtgtaaaatgccccctaaactttaaaatttatatt |
38833718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 45217737 - 45217673
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
45217737 |
caaataccccctgaaattttgcacttatgtgcaaaatgcccc-taaacttgaaaatttatattttt |
45217673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 105 - 174
Target Start/End: Original strand, 50642941 - 50643009
Alignment:
Q |
105 |
acgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||| || ||||||||||||||||||||| |||||||||| ||||||||||||| ||||| |
|
|
T |
50642941 |
acgttttgcaaataccctctgaagttttgcacttatgtgtaaaatgcccc-caaacttgaaaatgtatat |
50643009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 8897633 - 8897557
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| ||||| |||||||| ||||||||||||||||||| | | ||||||||||||||||| |
|
|
T |
8897633 |
aacataacgttttgcaaatacccccttgaagttttacacttatgtgcaaaatgcctcccgaacttgaaaatttatat |
8897557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 13698293 - 13698210
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||| |||||||||| |||| ||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
13698293 |
tgaacatgacaatttgcaaataccccccctgaagttttccacttatgtgcaaaatgccccatgaacttgaaaatttatattttt |
13698210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 21247499 - 21247423
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
21247499 |
aacatgatattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccatgaacttgaaaatttatat |
21247423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 28297271 - 28297195
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||| |||||||| || |||||||||||||||||| ||||||||||||||||| |
|
|
T |
28297271 |
aacatgacgttttgcaaatacccccttgaagttttacagttatgtgcaaaatgccccctgaacttgaaaatttatat |
28297195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 31050098 - 31050178
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| ||||| |||||| |||| |||||||||||| |||||||||||||||||| | || |||||||||||||||||| |
|
|
T |
31050098 |
aacatgaagttttacaaatacccccatgaagttttgcatttatgtgcaaaatgccccacgaatttgaaaatttatattttt |
31050178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 32186280 - 32186200
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||| |||| |||||||||||||||||||||||||||||| | || |||||||||||| ||||| |
|
|
T |
32186280 |
aacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccctccgaatttgaaaatttatgttttt |
32186200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 39364972 - 39365048
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||| |||||||||||||||||| | ||||||||||||||||| |
|
|
T |
39364972 |
aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgcctcatgaacttgaaaatttatat |
39365048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4631779 - 4631858
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| ||||| |||| | ||||||||||||||||||||||||| ||| |||||| |||||||||||| |
|
|
T |
4631779 |
tgaacatgacgttttgtaaatacccccctaaagttttgcacttatgtgcaaaatgaccccaaaacttaaaaatttatatt |
4631858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 9055744 - 9055823
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| |||| |||| ||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
9055744 |
tgaacataacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgcttcccaaacttaaaaatttatatt |
9055823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13158793 - 13158715
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| |||||||||||||||| |||||||||||||| |||| || |||||||||||| |
|
|
T |
13158793 |
tgaacatgatgttttgcaaatacccccctgaagttttgcacttacgtgcaaaatgcccc-caaatttaaaaatttatatt |
13158715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21040925 - 21040846
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| | |||| ||||||||||||||||||| ||||||||| ||||||| ||| |||||||| |
|
|
T |
21040925 |
tgaacatgacattttgcaaataccgccctaaagttttgcacttatgtgcgaaatgccccccaaacttaaaattttatatt |
21040846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 102 - 174
Target Start/End: Complemental strand, 26615765 - 26615691
Alignment:
Q |
102 |
atgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||| |||| |||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
T |
26615765 |
atgacgttttgcaaataccccccctgaagttttgcacttatgagcaaaatgccccttgaacttgaaaatttatat |
26615691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 34556954 - 34557029
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||| ||||| |||||||||||||| |||||||||||||||| || |||| || ||||||||||| |
|
|
T |
34556954 |
aacatgacgttttgtaaataccccctgaagttttgtacttatgtgcaaaatgtccaccaaatttaaaaatttatat |
34557029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42149114 - 42149036
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||| ||||||| |||| ||||||| |
|
|
T |
42149114 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaat-ccctccaaacttaaaaaattatatt |
42149036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 46585550 - 46585491
Alignment:
Q |
119 |
tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
46585550 |
tcccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaatttatattttt |
46585491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 48751679 - 48751730
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
48751679 |
aacaagacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatg |
48751730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 8742577 - 8742523
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
8742577 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat |
8742523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 9034547 - 9034493
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
9034547 |
tgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
9034493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 9680965 - 9680907
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
9680965 |
cccctgaaattttgtacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
9680907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13697722 - 13697798
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||| ||| | ||||||||||||||||||||||||||||||||| | ||||| |||||||||||| |
|
|
T |
13697722 |
tgaacatgatgttttgcatatacctcctgaagttttgcacttatgtgcaaaatgcccc-cgaactt-aaaatttatatt |
13697798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 173
Target Start/End: Original strand, 29487420 - 29487493
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata |
173 |
Q |
|
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||| |||||||||| ||||| |
|
|
T |
29487420 |
aacatgacgttttgcaaataccccct-aagttttgcacttatgtgcaaaatgtcccctgaacttgaaaaattata |
29487493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 35392638 - 35392692
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
35392638 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat |
35392692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 37327649 - 37327707
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
T |
37327649 |
cccctgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatctatattttt |
37327707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 43505955 - 43505901
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
43505955 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat |
43505901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 32536319 - 32536384
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||| ||||||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
32536319 |
caaataccccctgaaattttgcccttatgtgcaaaatgccccctaaacttgaaaatttatactttt |
32536384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 121 - 174
Target Start/End: Original strand, 35155242 - 35155294
Alignment:
Q |
121 |
ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
35155242 |
ccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatat |
35155294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 7287677 - 7287753
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||| ||||||||||||||||||||| |||||||| |||||||| |
|
|
T |
7287677 |
aacataacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccctgaacttgaacatttatat |
7287753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 27235129 - 27235053
Alignment:
Q |
99 |
aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||||||||| | |||||||||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
27235129 |
aacatgacattttgcaaataccaccctgaagttttgcacttatgtgcaaaatgcctcctgaacttaaaaatttatat |
27235053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 43282024 - 43281948
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| |||| |||||||||||||||||||||||||||| | | ||||| ||||||||||| |
|
|
T |
43282024 |
aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcttctcgaacttaaaaatttatat |
43281948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 151
Target Start/End: Complemental strand, 52870621 - 52870569
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc |
151 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| || ||||||||||||||| |
|
|
T |
52870621 |
aacatgacgttttgcaaataccccctgaagttttacatttatgtgcaaaatgc |
52870569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1023573 - 1023651
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| |||| |||||||||||| |||||||||||| | ||| ||||||| |||||||||||| |
|
|
T |
1023573 |
tgaacatgac-ttttgcaaatacccccctgaagttttgcaattatgtgcaaaaagtccctcaaacttaaaaatttatatt |
1023651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 17826958 - 17826904
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||| ||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
T |
17826958 |
aacatgacattttgcaaata-cccctgaagttttgtacttatgtgcaaaatgcccc |
17826904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 26189970 - 26189896
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||| ||||| |||||||||| ||||||| |||||||| |||| | ||||| ||||||||||| |
|
|
T |
26189970 |
aacatgacgttttgcaattatcctctgaagttttacacttatatgcaaaatacccc-cgaacttaaaaatttatat |
26189896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 175
Target Start/End: Complemental strand, 42128640 - 42128570
Alignment:
Q |
104 |
gacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| | |||||||||||||||||||||||| ||| |||| ||||| | |||||||||||| |
|
|
T |
42128640 |
gacgttttgcaaatacctcctgaagttttgcacttatgtgcagaatacccc-caaacataaaaatttatatt |
42128570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 43215298 - 43215223
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||| |||||| ||| ||||||||| |||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
43215298 |
aacatgacgttagacaaataccccatgaagttttatacttatgtgcaaaatgccccccaaacttaaaaatttatat |
43215223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 45142456 - 45142379
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| |||||||| || |||||||||||||||||| | |||||||||||| || ||||| |
|
|
T |
45142456 |
aacatgacgttttgcaaataccccc-gaagttttacagttatgtgcaaaatgcccc-ctaacttgaaaattcattttttt |
45142379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 163
Target Start/End: Complemental strand, 51547255 - 51547188
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttg |
163 |
Q |
|
|
||||||| ||||||| |||||| |||| ||||||||| ||||||||||||||||||||| |||||||| |
|
|
T |
51547255 |
tgaacataacgttttccaaatacccccctgaagttttacacttatgtgcaaaatgccccccaaacttg |
51547188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 8741884 - 8741942
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
8741884 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
8741942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 10373695 - 10373749
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
10373695 |
cccctgaaattttgcacttatgtgcaaaatgccctctaaacttgaaaatttatat |
10373749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 22388471 - 22388552
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||||||||||||| |||||| | | ||||| ||||||||||||||| |
|
|
T |
22388471 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgttaaatgcttcccgaacttaaaaatttatattttt |
22388552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 27326426 - 27326484
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
27326426 |
cccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaatttagattttt |
27326484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 27326972 - 27326914
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
T |
27326972 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaaaatatattttt |
27326914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 29487941 - 29487860
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||||||||||||||| |||| |||||||||||||||||| ||||||| ||| | ||||| ||||||||||||||| |
|
|
T |
29487941 |
aacaagacgttttgcaaataccccccctgaagttttgcacttatgcgcaaaattccctgtgaacttaaaaatttatattttt |
29487860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 36723442 - 36723500
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
36723442 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
36723500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 46584915 - 46584973
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
T |
46584915 |
cccctgaaattttgcacttatgtgcaaaatgccccctaattttgaaaatttatattttt |
46584973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 49216925 - 49216867
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
T |
49216925 |
cccctgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaatttatcttttt |
49216867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 114 - 171
Target Start/End: Complemental strand, 15926783 - 15926727
Alignment:
Q |
114 |
aaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
15926783 |
aaataccccctgaaattttgcacttatgtgcaaaatgcccc-taaacttgaaaattta |
15926727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 31058641 - 31058563
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| | ||||||||||||||| ||||||||||||| ||||| |||||||||||||| |
|
|
T |
31058641 |
aacatgacgttttgcaaatacccccataaagttttgcacttatttgcaaaatgccccctgaactt--aaatttatattttt |
31058563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 32537158 - 32537093
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| ||| || |||||||| |||||| |
|
|
T |
32537158 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaatttaaaaatttagattttt |
32537093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 174
Target Start/End: Complemental strand, 44432745 - 44432684
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||| |||||||| |||||||||||||| |||||||| || |||||||||||||||||| |
|
|
T |
44432745 |
caaataccccctgaaattttgcacttatgtccaaaatgctccataaacttgaaaatttatat |
44432684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 102 - 174
Target Start/End: Complemental strand, 7288250 - 7288179
Alignment:
Q |
102 |
atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||| |||||||||||| |||| |||||||||| ||||||| ||||||||||| |||||| ||||||||||| |
|
|
T |
7288250 |
atgaagttttgcaaatacccccctaagttttgcatttatgtgtaaaatgccccg-aaacttaaaaatttatat |
7288179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 166
Target Start/End: Complemental strand, 18807620 - 18807552
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaa |
166 |
Q |
|
|
|||||||||||||| ||||| |||| |||||||||||| |||| ||||||||||||| |||||||||| |
|
|
T |
18807620 |
aacatgacgttttgtaaatacccccctgaagttttgcagttatatgcaaaatgccccctaaacttgaaa |
18807552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 21246612 - 21246664
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||||||||||||||||| |||||| | |||||||||||||||||||| |
|
|
T |
21246612 |
tgaagttttgcacttatgtgcagaatgcctcataaacttgaaaatttatattt |
21246664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 22389158 - 22389082
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| |||| | |||||||||| ||||||| ||||| |||| | ||||||||||||||||| |
|
|
T |
22389158 |
aacatgatgttttgcaaatagccccctaaagttttgcaattatgtgtaaaataccccccgaacttgaaaatttatat |
22389082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 27134429 - 27134481
Alignment:
Q |
122 |
cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
27134429 |
cctgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaatttatat |
27134481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 32814355 - 32814430
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| ||||||||||| ||| ||||||||||| |||||||||| ||||||||| ||||||| ||||||||||| |
|
|
T |
32814355 |
aacatgatcttttgcaaatacccctctgaagttttgaacttatgtgc-aaatgccccccaaacttaaaaatttatat |
32814430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 44157125 - 44157069
Alignment:
Q |
122 |
cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
44157125 |
cctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
44157069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 46295477 - 46295401
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| || ||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
T |
46295477 |
aacatgatgttttgcaaatacccatctgaagttttgtacttatgtgcaaaatgccccctggacttgaaaatttatat |
46295401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 175
Target Start/End: Original strand, 10509650 - 10509704
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| || |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
10509650 |
cccctaaaattttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
10509704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 33740887 - 33740836
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| ||||||||||||||||||||||| || |||||||||||||||||| |
|
|
T |
33740887 |
ctgaaattttgcacttatgtgcaaaatgctccctaaacttgaaaatttatat |
33740836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 134
Target Start/End: Complemental strand, 38065611 - 38065576
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgc |
134 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
38065611 |
aacatgacgttttgcaaatatcccctgaagttttgc |
38065576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42413234 - 42413312
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||||||||||||||| |||| | |||||||||| |||||||||||||||||| | || || |||||||||||| |
|
|
T |
42413234 |
tgaatatgacgttttgcaaatacccccctaaagttttgcatttatgtgcaaaatgcccc-cgaatttaaaaatttatatt |
42413312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 43281312 - 43281366
Alignment:
Q |
102 |
atgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||||||||||||| |||| |||||||||||||||||||| |||||||||| |
|
|
T |
43281312 |
atgacgttttgcaaataccccccctgaagttttgcacttatgtgtaaaatgcccc |
43281366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 51597006 - 51596926
Alignment:
Q |
99 |
aacatgacgttttgcaaatat---cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||||||||||||||||||| ||||| ||||||||||||||||| |||||| ||| | ||||| |||||||||||||| |
|
|
T |
51597006 |
aacatgacgttttgcaaatatccccccctaaagttttgcacttatgttcaaaat-accctcgaacttaaaaatttatatttt |
51596926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6918782 - 6918704
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||| ||||||||||| | | ||||||||||||||||||||||||||| | | ||||| |||||||||||| |
|
|
T |
6918782 |
tgaatatgacattttgcaaataccgtccaaagttttgcacttatgtgcaaaatgcctcccgaacttaaaaatttatatt |
6918704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 9680418 - 9680476
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||| | |||||| |||||||| |||||| |
|
|
T |
9680418 |
cccctgaaattttgcacttatgtgcaaaatgcctcctaaacttaaaaatttagattttt |
9680476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 11706883 - 11706937
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
11706883 |
tgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
11706937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 14404511 - 14404434
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| | ||| ||||||||||||| ||||||||||| ||| | |||| |||||||||||| |
|
|
T |
14404511 |
tgaacatgactttttgcaaatacctcctaaagttttgcacttttgtgcaaaatgtccc-cgaactaaaaaatttatatt |
14404434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 18542238 - 18542162
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||||||||| |||| ||||||||||||||||| | ||||||||||| | ||||| ||||||||||| |
|
|
T |
18542238 |
aacatgacattttgcaaataccccccctgaagttttgcacttatttacaaaatgcccc-cgaacttaaaaatttatat |
18542162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 24480408 - 24480350
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||| ||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
24480408 |
cccctgaaattttgcgcttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
24480350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 24482098 - 24482152
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||| || ||||||||||| |
|
|
T |
24482098 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaatttaaaaatttatat |
24482152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 154
Target Start/End: Complemental strand, 44210017 - 44209983
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
44210017 |
cccctgaagttttgcacttatgtgcaaaatgcccc |
44209983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 48731561 - 48731507
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
T |
48731561 |
cccctgaagttttgcacttatgcgcaaaatgccctctgaacttgaaaatttatat |
48731507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 52580574 - 52580520
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||||||||||| | |||||| ||||||||||| |
|
|
T |
52580574 |
cccctgaaattttgcacttatgtgcaaaatgcctcctaaacttaaaaatttatat |
52580520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 151
Target Start/End: Original strand, 17825962 - 17826011
Alignment:
Q |
102 |
atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc |
151 |
Q |
|
|
||||||||||||||||| | |||||||||||||||||||| |||||||| |
|
|
T |
17825962 |
atgacgttttgcaaatactcgctgaagttttgcacttatgtacaaaatgc |
17826011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 43505391 - 43505456
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| ||||||| |||||||||||||||||| || ||| |||||||| |||||| |
|
|
T |
43505391 |
caaataccccctgaaattttgcatttatgtgcaaaatgccccttaagcttaaaaatttagattttt |
43505456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 34557854 - 34557779
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||| ||||| ||| || |||| |||||||||||||||||||| ||| |||||||||||| ||||| |
|
|
T |
34557854 |
aacatgacgttttggaaataaccctctaaagtcttgcacttatgtgcaaaatg-cccttaaacttgaaaatatatat |
34557779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 45216911 - 45216967
Alignment:
Q |
122 |
cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||||||| ||||||||| ||| |||||| ||||||||||||||| |
|
|
T |
45216911 |
cctgaaattttgcacttatatgcaaaatgtcccctaaacttaaaaatttatattttt |
45216967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 155
Target Start/End: Complemental strand, 10613784 - 10613749
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccg |
155 |
Q |
|
|
||||| |||||||||||||||||||||||||||||| |
|
|
T |
10613784 |
cccctaaagttttgcacttatgtgcaaaatgccccg |
10613749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 23703195 - 23703238
Alignment:
Q |
135 |
acttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| ||||||| |||||||||||||||||||||| |
|
|
T |
23703195 |
acttatgtgcaacatgccccctaaacttgaaaatttatattttt |
23703238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 142
Target Start/End: Complemental strand, 43594241 - 43594198
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgt |
142 |
Q |
|
|
||||| |||||||||||||| | ||||||||||||||||||||| |
|
|
T |
43594241 |
aacatcacgttttgcaaataccgcctgaagttttgcacttatgt |
43594198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 44744560 - 44744505
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| |||| ||||||||||||||||||| | ||||| ||||||||||||| |
|
|
T |
44744560 |
cccctgaaattttacacttatgtgcaaaatgcctcctaaactagaaaatttatatt |
44744505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 24482922 - 24482864
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||| |||||||||||||||||| || |||||| |||||||| |||||| |
|
|
T |
24482922 |
cccctgaaattttacacttatgtgcaaaatgcaccctaaacttaaaaatttagattttt |
24482864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 35393112 - 35393058
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| |||||||||||||||||||||||||| ||| || |||||||| |||||| |
|
|
T |
35393112 |
tgaaattttgcacttatgtgcaaaatgccccctaaatttaaaaatttagattttt |
35393058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 37328431 - 37328373
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| || |||||||||||||||||||||||||| |||||| ||| |||| |||||| |
|
|
T |
37328431 |
cccctaaaattttgcacttatgtgcaaaatgccccctaaacttaaaattttagattttt |
37328373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 43281364 - 43281417
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||||||||| ||||| ||| | ||||| ||||||||||| |
|
|
T |
43281364 |
cccctgaagttttgcacttatgtgc-aaatggcccccgaacttaaaaatttatat |
43281417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 154
Target Start/End: Original strand, 44209261 - 44209295
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| |
|
|
T |
44209261 |
cccctgaagttttgcacttaagtgcaaaatgcccc |
44209295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 128 - 178
Target Start/End: Complemental strand, 50643563 - 50643514
Alignment:
Q |
128 |
gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||| ||||||||| ||| | ||||||||||||||||||||| |
|
|
T |
50643563 |
gttttgcacttatatgcaaaatg-ccctcgaacttgaaaatttatattttt |
50643514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 7875644 - 7875579
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| ||| |||| ||||| | |||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
7875644 |
caaataccccttgaaattttgtaattatgtgcaaaatgccccctaaacttaaaaatttagattttt |
7875579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 177
Target Start/End: Complemental strand, 19076332 - 19076275
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
|||| |||||| || ||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
T |
19076332 |
ccccggaagttatgtacttatgtgcaaaattccccctaaacttgaatatttatatttt |
19076275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 177
Target Start/End: Complemental strand, 19124222 - 19124165
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
|||| |||||| || ||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
T |
19124222 |
ccccggaagttatgtacttatgtgcaaaattccccctaaacttgaatatttatatttt |
19124165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 52579792 - 52579857
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||| ||||||||| |||||| |||||||| |||||| |
|
|
T |
52579792 |
caaataccccctgaaattttgcacttatgtagaaaatgcccaataaacttaaaaatttagattttt |
52579857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 38623239 - 38623295
Alignment:
Q |
122 |
cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||||||| || |||||||||| |||||| |||||||| |||||| |
|
|
T |
38623239 |
cctgaaattttgcacttatatgtaaaatgccccataaacttaaaaatttagattttt |
38623295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 120 - 164
Target Start/End: Original strand, 44156588 - 44156632
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga |
164 |
Q |
|
|
|||||| | |||||||||||||||||||||||||| |||||||| |
|
|
T |
44156588 |
cccctgtaattttgcacttatgtgcaaaatgccccctaaacttga |
44156632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 51546550 - 51546598
Alignment:
Q |
105 |
acgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgcc |
152 |
Q |
|
|
|||||||||||||| ||||| ||| ||||||| |||||||||||||||| |
|
|
T |
51546550 |
acgttttgcaaatactccccagaaattttgcatttatgtgcaaaatgcc |
51546598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 67; Significance: 2e-29; HSPs: 86)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 11625343 - 11625265
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
11625343 |
tgaacgtgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
11625265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 23767719 - 23767641
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
23767719 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
23767641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 18739278 - 18739199
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
18739278 |
tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
18739199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13045749 - 13045827
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
13045749 |
tgaacatgacgttttgcaaatgccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
13045827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 1326606 - 1326683
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
1326606 |
gaacatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
1326683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 748766 - 748845
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
T |
748766 |
tgaacatgacgttttgcaaatactcccctgaagttttgcacttgtgtgcaaaatgccccccaaacttaaaaatttatatt |
748845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1060341 - 1060263
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
1060341 |
tgaacatgacgttttgcaaatattcccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
1060263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 2318432 - 2318353
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
2318432 |
tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
2318353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8812180 - 8812259
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
8812180 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccacaaacttaaaaatttatatt |
8812259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8812811 - 8812732
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
8812811 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccacaaacttaaaaatttatatt |
8812732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13209212 - 13209291
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
13209212 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
13209291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13209820 - 13209741
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
13209820 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
13209741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 20856847 - 20856926
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
20856847 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
20856926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 29678933 - 29678854
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
29678933 |
tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
29678854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 2317825 - 2317902
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
2317825 |
tgaacatgacgttttgcaaataccccctgacgttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
2317902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 5430324 - 5430401
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
5430324 |
tgaacatgacgttttgcaaata-cccctgaagtcttgcacttatgtgcaaaatgccccccaaactttaaaatttatatt |
5430401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 8743041 - 8742963
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
8743041 |
tgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
8742963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8748843 - 8748921
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
8748843 |
tgaatatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
8748921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17994190 - 17994268
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||| |||||||||||| |
|
|
T |
17994190 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgctcccaaaacttaaaaatttatatt |
17994268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 170
Target Start/End: Complemental strand, 24111006 - 24110933
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
T |
24111006 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaattt |
24110933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 15145910 - 15145990
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
15145910 |
tgaacatgacgttttgcaaatactccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
15145990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 20857455 - 20857372
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
T |
20857455 |
tgaacatgacgtattgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt |
20857372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 23075298 - 23075218
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
23075298 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatattttt |
23075218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 5417593 - 5417672
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
5417593 |
tgaacatgacattttgcaaataccccgctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
5417672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23066772 - 23066851
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
23066772 |
tgaacatgacgttttacaaatatccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
23066851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26609832 - 26609911
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
26609832 |
tgaacatgacattttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
26609911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 26610399 - 26610320
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
26610399 |
tgaacatgccgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt |
26610320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1059734 - 1059814
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
1059734 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt |
1059814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1327204 - 1327125
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
1327204 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
1327125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 22821267 - 22821347
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
22821267 |
tgaacattacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
22821347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 28537658 - 28537738
Alignment:
Q |
99 |
aacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
28537658 |
aacataacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatttt |
28537738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 169
Target Start/End: Complemental strand, 32628626 - 32628553
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt |
169 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
T |
32628626 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatt |
32628553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 100 - 175
Target Start/End: Original strand, 15127152 - 15127228
Alignment:
Q |
100 |
acatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||| ||||||| |||||||||||| |
|
|
T |
15127152 |
acatgacgttttgcaaatacccctctgaagttttgcacttatgtggaaaatgccccccaaacttaaaaatttatatt |
15127228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23767090 - 23767172
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata---tcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
23767090 |
tgaacatgacgttttgcaaatactttccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
23767172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1155352 - 1155274
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||| ||||||| |||||||||||| |
|
|
T |
1155352 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatatgcaaaatgcccc-caaacttaaaaatttatatt |
1155274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 15146520 - 15146441
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||| |||||||||||||| ||||| | |||||||||||| |
|
|
T |
15146520 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttacgtgcaaaatgccccccaaacataaaaatttatatt |
15146441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 15968636 - 15968715
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||| || | ||||||| |||||||||||| |
|
|
T |
15968636 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaattccgcccaaacttaaaaatttatatt |
15968715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25404211 - 25404290
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| |||||| |||||||||||| |
|
|
T |
25404211 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccctaaacttaaaaatttatatt |
25404290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 102 - 175
Target Start/End: Complemental strand, 11158745 - 11158671
Alignment:
Q |
102 |
atgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||| || ||| ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
11158745 |
atgacgttttgcaaataccctcctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
11158671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 22504359 - 22504436
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata |
173 |
Q |
|
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
T |
22504359 |
gaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata |
22504436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 170
Target Start/End: Complemental strand, 25404822 - 25404749
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
T |
25404822 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaattt |
25404749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 749367 - 749287
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
749367 |
tgaacatgacgttttacaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt |
749287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1050844 - 1050764
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||| |||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
1050844 |
tgaacatgacgttttgcaaataccccccttgaagttttgcatttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
1050764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 29678323 - 29678403
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||| ||| |||| |
|
|
T |
29678323 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaattttttatt |
29678403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 34657940 - 34658016
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||| |||||||||| |||||||||| | ||||||||||||||||| |
|
|
T |
34657940 |
aacatgacgttttgcaaatacccccctgaagttttacacttatgtggaaaatgccccccgaacttgaaaatttatat |
34658016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8939938 - 8940017
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||| |||||||||| |||||||||||||||||| |||||| |||| ||||||| |
|
|
T |
8939938 |
tgaacatgacgttttgcaaatactcccctaaagttttgcatttatgtgcaaaatgccccccaaactaaaaaaattatatt |
8940017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 101 - 175
Target Start/End: Original strand, 11624739 - 11624814
Alignment:
Q |
101 |
catgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||| ||| ||||||||||||||| |||||||||||||||| |||||| |||||||||||| |
|
|
T |
11624739 |
catgacgttttgcaaataccccactgaagttttgcactcatgtgcaaaatgcccccaaaacttaaaaatttatatt |
11624814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 25163618 - 25163705
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc-----gcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||| |
|
|
T |
25163618 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacgtatgtgcaaaatgcccccccctccaaacttaaaaatttatattttt |
25163705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 16894570 - 16894628
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
16894570 |
cccctgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttatattttt |
16894628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 22822149 - 22822069
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||| ||||||| |||||||||| ||||||| |||||| ||||| |
|
|
T |
22822149 |
tgaacatgacgttttgcaaataccccccctgaagttttgcagttatgtgaaaaatgccccccaaacttaaaaattgatatt |
22822069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 10624593 - 10624673
Alignment:
Q |
99 |
aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| |||||||||||| | |||||||||||||||||||| |||||||| |||| | ||||| ||||||||||||||| |
|
|
T |
10624593 |
aacatgatgttttgcaaataccaccctgaagttttgcacttatatgcaaaattcccctcgaacttaaaaatttatattttt |
10624673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 14394807 - 14394866
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
T |
14394807 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc |
14394866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 148
Target Start/End: Complemental strand, 22504944 - 22504892
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaa |
148 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
22504944 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaa |
22504892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 170
Target Start/End: Complemental strand, 32155281 - 32155209
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| | ||||| ||||||| |
|
|
T |
32155281 |
aacatcacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaattt |
32155209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 6138329 - 6138250
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||| |||||| | |||||||||||||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
T |
6138329 |
aacatgacgttttacaaataccatctgaagttttgcacttatgtgcaaaatgcctcatgaacttaaaaatttatattttt |
6138250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 11099065 - 11099144
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| |||| |||||||||| |||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
T |
11099065 |
aacataacgttttgcaaatacccccctgaagttttgtacttatttgcaaaatgtcccctaaacttgaaaatttatatttt |
11099144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 11099944 - 11099869
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||| |||||| ||||||||| |||||| ||| ||||||||||||||||| |
|
|
T |
11099944 |
aacatgacgttttgcaaataccccctgatgttttgtacttatgtgtaaaatgtcccctgaacttgaaaatttatat |
11099869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 120 - 175
Target Start/End: Original strand, 24110431 - 24110486
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||| |
|
|
T |
24110431 |
cccctgaagttttgcacttatttgcaaaatgccccccaaacttaaaaatttatatt |
24110486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 5400814 - 5400731
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttat----gtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || |||||||||||| |||||| |||||||||||||| ||||||| |||||||||||| |
|
|
T |
5400814 |
tgaacatgacgttttgcaaatacccacctgaagttttgtacttatatatgtgcaaaatgccccccaaacttaaaaatttatatt |
5400731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 15191945 - 15192003
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
T |
15191945 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttaaattttt |
15192003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 15468606 - 15468548
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
T |
15468606 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttaaattttt |
15468548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1049976 - 1050056
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||| ||||| ||| | ||||| |||||||||||| |
|
|
T |
1049976 |
tgaacatgatgttttgcaaataccccccctgaagttttgcacttatgtgccaaatgtcccccgaacttaaaaatttatatt |
1050056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 11640972 - 11641037
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
11640972 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt |
11641037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 16895123 - 16895058
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
16895123 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt |
16895058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 1798662 - 1798729
Alignment:
Q |
113 |
caaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||| |||| |||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
1798662 |
caaatatcccccttgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt |
1798729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 143
Target Start/End: Complemental strand, 15127667 - 15127620
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtg |
143 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
15127667 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtg |
15127620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 29724054 - 29723995
Alignment:
Q |
119 |
tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
29724054 |
tcccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
29723995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 127 - 174
Target Start/End: Complemental strand, 34658490 - 34658443
Alignment:
Q |
127 |
agttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
34658490 |
agttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
34658443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 1563954 - 1563873
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||| |||||||||| | | |||||||||||||||||||| || ||| ||||||||||||||||||||| |
|
|
T |
1563954 |
aacatgacgttttgtaaatatcccccttaacgttttgcacttatgtgcaaagtgtcccttgaacttgaaaatttatattttt |
1563873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 23074434 - 23074515
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||| |||| |||||||||||| |||||||||||||||||| |||||| |||||| || ||||| |
|
|
T |
23074434 |
aacatgacattttgcaaataccccccctgaagttttgcatttatgtgcaaaatgccccctaaacttaaaaattcattttttt |
23074515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 18738453 - 18738527
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||| || ||||||| ||| ||||||| |||||||||||| |
|
|
T |
18738453 |
aacatgacgttttgcaaataccccctgaagttttgcac--ataaacaaaatgtcccccaaacttaaaaatttatatt |
18738527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 99 - 152
Target Start/End: Original strand, 32154608 - 32154661
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcc |
152 |
Q |
|
|
||||||| ||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
T |
32154608 |
aacatgatattttgcaaacaccccctgaagttttgcacttatgtgcaaaatgcc |
32154661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 11957110 - 11957190
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||| |||||||| |||| ||||||| ||||||||||| ||||| ||||| ||||| ||||||||||||||| |
|
|
T |
11957110 |
aacatgacgttatgcaaatacccccctgaagttgtgcacttatgtacaaaaggccccctgaacttcaaaatttatattttt |
11957190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 26583136 - 26583082
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
T |
26583136 |
cccctgaaattttgcacttatgtgcaaaatgccctctaaacttgaacatttatat |
26583082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 28538246 - 28538193
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||| |||||||||||||||| |
|
|
T |
28538246 |
aacatgacgttttgcaaataccccccctgaagttttgtacttatgtgcaaaatg |
28538193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 166
Target Start/End: Original strand, 29212912 - 29212958
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaa |
166 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
T |
29212912 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaa |
29212958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 137 - 178
Target Start/End: Original strand, 8589824 - 8589865
Alignment:
Q |
137 |
ttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
8589824 |
ttatgtgcaaaatgccccataaacttgaaaatttatattttt |
8589865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 129 - 174
Target Start/End: Complemental strand, 32597155 - 32597110
Alignment:
Q |
129 |
ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||||||| || |||||||||||||||||| |
|
|
T |
32597155 |
ttttgcacttatgtgcaaaatgctccttaaacttgaaaatttatat |
32597110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 162
Target Start/End: Original strand, 14608188 - 14608252
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaactt |
162 |
Q |
|
|
|||||||||||||||||||| |||| | |||||||| ||||| |||||||||||| | ||||||| |
|
|
T |
14608188 |
aacatgacgttttgcaaataccccccttaagttttgtacttacgtgcaaaatgccgctcaaactt |
14608252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 1563032 - 1563110
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| ||||||| ||||||||||| ||||||||||| |||||| ||| ||||| ||||||||| ||||| |
|
|
T |
1563032 |
aacatgacgttt-gcaaataccccctgaagttatgcacttatgtacaaaatatcccctgaacttaaaaatttatgttttt |
1563110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 171
Target Start/End: Original strand, 32596473 - 32596524
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||| |||||| |||||||| |
|
|
T |
32596473 |
cccctgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaattta |
32596524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 8590630 - 8590580
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
8590630 |
tgaaattttgcacttatgtgcaaaatgcccgctgaacttgaaaatttatat |
8590580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 15468059 - 15468117
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||| |||||| ||||||||||||| |||||| |||||||| |||||| |
|
|
T |
15468059 |
cccctgaaattttggacttatatgcaaaatgccccataaacttaaaaatttagattttt |
15468117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 137 - 175
Target Start/End: Complemental strand, 17994757 - 17994719
Alignment:
Q |
137 |
ttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
17994757 |
ttatgtgcaaaatgccccccaaacttaaaaatttatatt |
17994719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 29723224 - 29723290
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaa-atttatattttt |
178 |
Q |
|
|
|||||| |||| ||| |||||||||||||| ||||||||||| |||||| ||| |||||||||||| |
|
|
T |
29723224 |
caaataccccccgaaattttgcacttatgtacaaaatgccccctaaactttaaatatttatattttt |
29723290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 140
Target Start/End: Original strand, 23597171 - 23597204
Alignment:
Q |
107 |
gttttgcaaatatcccctgaagttttgcacttat |
140 |
Q |
|
|
||||||||||||||||||||||||||| |||||| |
|
|
T |
23597171 |
gttttgcaaatatcccctgaagttttgtacttat |
23597204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 67; Significance: 2e-29; HSPs: 211)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4153165 - 4153088
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
4153165 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
4153088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6680625 - 6680703
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6680625 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
6680703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 25338868 - 25338790
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
25338868 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
25338790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 29373959 - 29373881
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
29373959 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
29373881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38395516 - 38395594
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
38395516 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
38395594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7482368 - 7482447
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
7482368 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
7482447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 16048514 - 16048593
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
16048514 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
16048593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 100 - 175
Target Start/End: Complemental strand, 16869210 - 16869135
Alignment:
Q |
100 |
acatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
16869210 |
acatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
16869135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 22613571 - 22613492
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
22613571 |
tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
22613492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1829535 - 1829613
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
1829535 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt |
1829613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 11445194 - 11445272
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
11445194 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccacccaaacttaaaaatttatatt |
11445272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 171
Target Start/End: Complemental strand, 12404310 - 12404236
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
T |
12404310 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaattta |
12404236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32273101 - 32273023
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
32273101 |
tgaacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
32273023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40315002 - 40315080
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
40315002 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt |
40315080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 8407516 - 8407593
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
8407516 |
tgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
8407593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 36778325 - 36778406
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| |||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||| |
|
|
T |
36778325 |
tgaacatgacgttttgcaaataccccctgaatttttgcacttatatgcaaaatgtccctcaaacttgaaaatttatattttt |
36778406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 41411931 - 41412008
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
41411931 |
gaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
41412008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 6845076 - 6845159
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
T |
6845076 |
tgaacatgacgttttgcaaatacaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt |
6845159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 459604 - 459683
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
459604 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
459683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 2061326 - 2061247
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
2061326 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
2061247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 3508185 - 3508264
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
3508185 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
3508264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 3508794 - 3508715
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
3508794 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
3508715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4152558 - 4152637
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
4152558 |
tgaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
4152637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4844404 - 4844325
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
4844404 |
tgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt |
4844325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6166621 - 6166542
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6166621 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt |
6166542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 6915401 - 6915322
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
T |
6915401 |
aacatgacgttttgcaaataacccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaattaatattttt |
6915322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8160070 - 8160149
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
8160070 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
8160149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8160676 - 8160597
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
8160676 |
tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
8160597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 12403694 - 12403773
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
12403694 |
tgaacatgacgttttgcaaatagccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
12403773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 12737019 - 12736940
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
12737019 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
12736940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 12799234 - 12799313
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
12799234 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
12799313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 12799842 - 12799763
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
12799842 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
12799763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13307070 - 13306991
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
13307070 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
13306991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26395523 - 26395602
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
26395523 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
26395602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38483663 - 38483584
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
38483663 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
38483584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39406193 - 39406272
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
39406193 |
tgaacatgacgttttgcaaatatccctctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt |
39406272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 40195963 - 40195884
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
40195963 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
40195884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42437889 - 42437968
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
42437889 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
42437968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4843796 - 4843874
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| | |||||||||||| |||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
4843796 |
tgaacatgacgttttgcaaatacctcctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
4843874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 16353036 - 16353114
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
16353036 |
tgaatatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaactaaaaaatttatatt |
16353114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38465234 - 38465312
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
38465234 |
tgaacatgacgttttgcaaatacccactgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt |
38465312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41412537 - 41412459
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||| ||||||| |
|
|
T |
41412537 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaaattatatt |
41412459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 1830141 - 1830064
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
1830141 |
gaacatgacattttgcaaataccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
1830064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 9772365 - 9772445
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
9772365 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
9772445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 11445803 - 11445723
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
11445803 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
11445723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 25482589 - 25482509
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
25482589 |
tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
25482509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 29373354 - 29373430
Alignment:
Q |
99 |
aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
29373354 |
aacatgacgttttgcaaatattcccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
29373430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40195362 - 40195442
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
40195362 |
tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt |
40195442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 40315608 - 40315531
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
40315608 |
gaacatgacattttgcaaataccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
40315531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 11277474 - 11277394
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
11277474 |
aacatcacgttttgcaaatactcccctgaagttttgcgcttatgtgcaaaatgccctccaaacttgaaaatttatattttt |
11277394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 100 - 175
Target Start/End: Original strand, 12366625 - 12366701
Alignment:
Q |
100 |
acatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
12366625 |
acatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
12366701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 970538 - 970616
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
970538 |
tgaacatgacgttttgcaaatatcctcatgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
970616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 2060716 - 2060795
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
2060716 |
tgaacatgacgtttttcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
2060795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4299665 - 4299587
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||| |||||||||||| |
|
|
T |
4299665 |
tgaacatgacgttttgcaaatatccacctgaagttttgcacttatgtgcaaaatgcccc-caagcttaaaaatttatatt |
4299587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4912533 - 4912454
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
4912533 |
tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
4912454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 5576482 - 5576561
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||| || ||||| |
|
|
T |
5576482 |
aacatgacgttttgcaaataccccctgaagttttgcagttatgtgcaaaatgccccctaaacttgaaaattcattttttt |
5576561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7482967 - 7482888
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
7482967 |
tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
7482888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 9475314 - 9475392
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
9475314 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
9475392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 9475919 - 9475840
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
9475919 |
tgaacatgacgttttgcaaatacccccttgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
9475840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 12367230 - 12367151
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||| |||||||||||||| ||||||| |||||||||||| |
|
|
T |
12367230 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttacgtgcaaaatgccccccaaacttaaaaatttatatt |
12367151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 12736410 - 12736489
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
12736410 |
tgaacatgacgttttgcaaataccccccagaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
12736489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13306467 - 13306546
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
13306467 |
tgaacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
13306546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 16868588 - 16868667
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
16868588 |
tgaagatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
16868667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17526191 - 17526270
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
17526191 |
tgaacatgacgttttgcaaatacccccctgaagttctgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
17526270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 18146412 - 18146334
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
18146412 |
tgaacatgacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
18146334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25481979 - 25482058
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
25481979 |
tgaacatgacgttttgcaaataccccctaaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttatatt |
25482058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 27188700 - 27188626
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
27188700 |
aacatgatgttttgcaaatatcctctgaagttttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttatat |
27188626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 32272494 - 32272573
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
32272494 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
32272573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36810944 - 36811023
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| | || ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36810944 |
tgaacatgacgttttgcaaatacctccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
36811023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38144010 - 38143931
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
38144010 |
tgaacatgacgttttgcaaatatccccatgaagttttgagcttatgtgcaaaatgccccccaaacttaaaaatttatatt |
38143931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39760703 - 39760782
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
39760703 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
39760782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39761313 - 39761234
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
39761313 |
tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
39761234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 41085308 - 41085233
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| ||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||| |
|
|
T |
41085308 |
aacatgatgttttgcaaataccccctgaagttttacacttatgtacaaaatgccccccaaacttgaaaatttatat |
41085233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 172
Target Start/End: Complemental strand, 460218 - 460141
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat |
172 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
T |
460218 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttat |
460141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 1144355 - 1144278
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
1144355 |
aacatgacgttttgcaaatatcccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat |
1144278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6166017 - 6166093
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
6166017 |
tgaacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgctcc-caaacttaaaaatttatatt |
6166093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 6809453 - 6809372
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
6809453 |
aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaaatttatattttt |
6809372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8408127 - 8408050
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
8408127 |
tgaacatgacgttt-gcaaataccccctgaagttttgcgcttatgtgcaaaatgccccccaaacttaaaaatttatatt |
8408050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36779170 - 36779092
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| || ||||||||| |||||||||||||||| ||||||| |||||||||||| |
|
|
T |
36779170 |
tgaacatgacgttttgcaaataccccctaaaattttgcactgatgtgcaaaatgccccccaaacttaaaaatttatatt |
36779092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 36811538 - 36811456
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||| ||||||| ||||||||||||||| |
|
|
T |
36811538 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatttcccccaaacttaaaaatttatattttt |
36811456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4911923 - 4912003
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
T |
4911923 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt |
4912003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17085936 - 17086016
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
17085936 |
tgaacttgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
17086016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 19289863 - 19289783
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||| |||||||| |
|
|
T |
19289863 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaactttatatt |
19289783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21632399 - 21632319
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
21632399 |
tgaacattacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
21632319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21640646 - 21640566
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
21640646 |
tgaacattacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
21640566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 26396132 - 26396053
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||| |||||| |
|
|
T |
26396132 |
tgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgtgcaaaatgccccccaaactt-aaaatatatatt |
26396053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38465810 - 38465730
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
38465810 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt |
38465730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 1143777 - 1143856
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
1143777 |
tgaacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
1143856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 4104060 - 4104138
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
4104060 |
gaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
4104138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 5577346 - 5577266
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
5577346 |
aacatgacgttttgcaaatactcccctgaacttttgcacttatgtgcaaaatgccccctgaacatgaaaatttatattttt |
5577266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 6845686 - 6845607
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
6845686 |
gaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
6845607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 38424929 - 38424853
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
38424929 |
aacatgatgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccatgaacttgaaaatttatat |
38424853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 41210209 - 41210130
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
41210209 |
tgaacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat |
41210130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 17526800 - 17526721
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| || |||||||||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
17526800 |
tgaacatgacattttgcaaataccctcctgaagttttgcacttatgtgcaaaatgctccccaaacttaaaaatttatatt |
17526721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 19289253 - 19289332
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
19289253 |
tgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttatatt |
19289332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38186562 - 38186641
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||| | |||||||||||| |
|
|
T |
38186562 |
tgaacatgacgttttgcaaatactccccaaaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt |
38186641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38211795 - 38211716
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||| | |||||||||||| |
|
|
T |
38211795 |
tgaacatgacgttttgcaaatactccccaaaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt |
38211716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 38977695 - 38977774
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||| |
|
|
T |
38977695 |
aacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaattttttattttt |
38977774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 41209630 - 41209704
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||| |||| | ||||||||||||||||| |
|
|
T |
41209630 |
aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatacccc-cgaacttgaaaatttatat |
41209704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4104935 - 4104857
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| |||||| ||||||||||||||||||||| ||||| |||||| ||||||| |||||||||||| |
|
|
T |
4104935 |
tgaacatgacgttttacaaataccccctgaagttttgcacttatctgcaagatgccctccaaacttaaaaatttatatt |
4104857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 7951451 - 7951375
Alignment:
Q |
99 |
aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
7951451 |
aacatgacgttttccaaatacctcccctgaagttttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttatat |
7951375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 9772973 - 9772895
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||| | || |||||||||| |||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
9772973 |
gaacatgacgttttgcaaacaccctcctgaagtttggcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
9772895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 15180585 - 15180662
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
T |
15180585 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-aaaacttaaaaatttatat |
15180662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 18145807 - 18145884
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| ||||||||||||| |||| ||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
18145807 |
tgaacatgtcgttttgcaaataccccc-gaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
18145884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 169
Target Start/End: Original strand, 19292364 - 19292434
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt |
169 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
T |
19292364 |
aacatgacgttttgcaaataccccccgaagttttgcagttatgtgcaaaatgccccctaaacttgaaaatt |
19292434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 25338258 - 25338316
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
25338258 |
tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgcccc |
25338316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6681234 - 6681155
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
6681234 |
tgaacatgacgttttgcaaacaccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
6681155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 25823708 - 25823631
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||||| || | ||| | |||||||||||| |
|
|
T |
25823708 |
gaacatgacgctttgcaaataccccctgaagttttgcacttatgtgcaaaatgcgccccgaacctaaaaatttatatt |
25823631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38396119 - 38396039
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||||| |||||||||||| |
|
|
T |
38396119 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgaaaaatgccctccaaacttaaaaatttatatt |
38396039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42341261 - 42341341
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
42341261 |
tgaacataacgttttacaaatacaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
42341341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 3307269 - 3307193
Alignment:
Q |
99 |
aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| || |||||||||||| ||||||||||||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
3307269 |
aacataacattttgcaaatatgcccctgaagttttgcacttatgtgcaaaatgccccccgaactttaaaatttatat |
3307193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 17647420 - 17647496
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
17647420 |
aacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatat |
17647496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 20730997 - 20731069
Alignment:
Q |
102 |
atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
20730997 |
atgacgttttgcaaataccccccgaagttttgcacttatgtgcaaaatgccccttgcacttgaaaatttatat |
20731069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 27257156 - 27257231
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||| | |||| || |||||||||||| |
|
|
T |
27257156 |
aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgcctc-caaatttaaaaatttatatt |
27257231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 5575015 - 5574936
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||| ||||||| ||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
T |
5575015 |
aacataacgtttggcaaatacccccttgaagttttgcacttatatgcaaaatgccccataaacttgaaaatttatatttt |
5574936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 14197963 - 14197884
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||| ||||| ||| ||| ||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
T |
14197963 |
aacatgacgttttgtaaataccccatgatgttttgcacttatatgcaaaatgccccttgaacttgaaaatttatattttt |
14197884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 101 - 175
Target Start/End: Complemental strand, 15181190 - 15181115
Alignment:
Q |
101 |
catgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
15181190 |
catgacgttttttaaatatccccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
15181115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24324477 - 24324555
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||| |||| | ||||||||||||| |||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
24324477 |
tgaacatgacgttttgcgaatacctccctgaagttttggacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
24324555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24361101 - 24361179
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||| |||| | ||||||||||||| |||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
24361101 |
tgaacatgacgttttgcgaatacctccctgaagttttggacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
24361179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24361709 - 24361630
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||| |||| ||||||||||||||||||||| ||||||| ||||||| |||| |
|
|
T |
24361709 |
tgaacatgacgttttgcaaatacccccctgaaattttacacttatgtgcaaaatgccccccaaacttaaaaatttgtatt |
24361630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 27341984 - 27341902
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaa-atttatattttt |
178 |
Q |
|
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
T |
27341984 |
aacatgatgttttgcaaatatcccccttgaagttttgcacttatgtgcaaaatgccccccgaacttgaaatttttatattttt |
27341902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42341868 - 42341790
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| ||||| |||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
42341868 |
tgaacgtgacgatttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
42341790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 11157082 - 11157163
Alignment:
Q |
99 |
aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| |||||||||||| ||||||||||||||||||||||||| |||||||| | |||||| ||||||| |||||||| |
|
|
T |
11157082 |
aacatgaagttttgcaaatacctcccctgaagttttgcacttatgtggaaaatgcctcccaaactcgaaaattcatattttt |
11157163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 29235610 - 29235668
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
29235610 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
29235668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 38978394 - 38978317
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
38978394 |
aacataacgttttgcaaataccccccttgaagttttgcacttatgtgcaaaatgccccccgaactttaaaatttatat |
38978317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42438532 - 42438455
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| || |||| ||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
T |
42438532 |
tgaacatgacgttttgcaaata-cctttgaaattttgcacttatgtgcaaaatgctccccaaacttaaaaatttatatt |
42438455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 6865342 - 6865265
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
6865342 |
aacatgacgttttgcaaatacgcccttgaagttttgcacttatgtgcaaaatgccctctaaacttaaaaatttatatt |
6865265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 164
Target Start/End: Complemental strand, 11157982 - 11157917
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga |
164 |
Q |
|
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||| ||| | ||||||| |
|
|
T |
11157982 |
aacatgaagttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccccgaacttga |
11157917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 43067665 - 43067718
Alignment:
Q |
122 |
cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
43067665 |
cctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
43067718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 5790487 - 5790431
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
T |
5790487 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc |
5790431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 8505979 - 8505903
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
T |
8505979 |
aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccctctgaacttgaaaatttatat |
8505903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 26359830 - 26359754
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||| ||| |||||||||||||||| ||||||||||||||||| |
|
|
T |
26359830 |
aacatgacgttttgcaaatacccccctgaagttttgtactcatgtgcaaaatgccccatgaacttgaaaatttatat |
26359754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 170
Target Start/End: Original strand, 27341299 - 27341371
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||| ||||||| |
|
|
T |
27341299 |
aacatcacgttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgccctccgaacttaaaaattt |
27341371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 6808467 - 6808545
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||||||| |||| |||||||||||||||||| | ||||||| ||| ||||||||||| |
|
|
T |
6808467 |
aacatgacgttttgcaaata-cccctgaaattttccacttatgtgcaaaatgcttcccaaacttaaaagtttatattttt |
6808545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 6835344 - 6835269
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||| ||||| ||| ||||||||||||||||||||||||||||||| | || || ||||||||||| |
|
|
T |
6835344 |
aacatgatgttttgaaaataccccttgaagttttgcacttatgtgcaaaatgcccctcgaatttaaaaatttatat |
6835269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 100 - 174
Target Start/End: Complemental strand, 13545387 - 13545310
Alignment:
Q |
100 |
acatgacgttttgcaaatat---cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||| |||||||||||| ||||||||||||||||||||||||||||||||| | | ||||||||||||||||| |
|
|
T |
13545387 |
acatgatgttttgcaaatacacccccctgaagttttgcacttatgtgcaaaatgcctcccgaacttgaaaatttatat |
13545310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24325084 - 24325005
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||| |||| |||| |||||||||||||||| ||||||| ||||||| |||| |
|
|
T |
24325084 |
tgaacatgacgttttgcaaatacccccctgaaattttacactaatgtgcaaaatgccccccaaacttaaaaatttgtatt |
24325005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 26359273 - 26359352
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| || |||||||||||||| |||||||||||||| ||| |||||| |||||||||||||| |
|
|
T |
26359273 |
aacataacgttttgcaaataccctcctgaagttttgcatttatgtgcaaaatgtcccctaaacttaaaaatttatatttt |
26359352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 746501 - 746555
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
746501 |
tgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt |
746555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 2745449 - 2745391
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
T |
2745449 |
cccctgaaattttgcacttatgtgcaaaacgccccttaaacttgaaaatttatattttt |
2745391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 5574098 - 5574175
Alignment:
Q |
99 |
aacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
5574098 |
aacatgacgttttgcaaatactccccctgaagttttttacttatgtgcaaaatgccccttgaacttgaaaatttatat |
5574175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 171
Target Start/End: Original strand, 6864466 - 6864539
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||||||| |||||||| |
|
|
T |
6864466 |
tgaacatgacgttttgcaaatactttctgaagttttgtacttatgtgcaaaatgcccc-caaacttaaaaattta |
6864539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 26394847 - 26394789
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
26394847 |
cccctgaaattttacacttatgtgcaaaatgccccataaacttgaaaatttatattttt |
26394789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 27500872 - 27500818
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
27500872 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat |
27500818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 32293754 - 32293831
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||| ||||||||||||||| |||| | ||||||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
32293754 |
tgaacaagacgttttgcaaatacccccataaagttttgcacttatgtgcaaaatgcccc-cgaacttaaaaatttatat |
32293831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 38090484 - 38090542
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
T |
38090484 |
cccctgaaattttgcacttatgtgcaaaatgtcccataaacttgaaaatttatattttt |
38090542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 40988832 - 40988779
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
40988832 |
tgaaattttgcacttatgtgcaaaatgcccc-caaacttgaaaatttatattttt |
40988779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 4000006 - 4000071
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
4000006 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
4000071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 146
Target Start/End: Complemental strand, 16362848 - 16362799
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaa |
146 |
Q |
|
|
|||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
T |
16362848 |
tgaacatgacgttttgcaaatacctcctgaagttttgcacttatgtgcaa |
16362799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 36498622 - 36498671
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt |
169 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
36498622 |
cccctgaaattttgcacttatgtgcaaaatgccccacaaacttgaaaatt |
36498671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 2301376 - 2301297
Alignment:
Q |
99 |
aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
||||||||||||| |||||| || | ||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
2301376 |
aacatgacgttttacaaatacatcacatgaagttttacacttatgtgcaaaatgcccctttaacttgaaaatttatattt |
2301297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 98 - 169
Target Start/End: Original strand, 7978570 - 7978642
Alignment:
Q |
98 |
gaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt |
169 |
Q |
|
|
||||||||| ||||||||||||| || ||||||||||||||||||||||||||| || ||||||| |||||| |
|
|
T |
7978570 |
gaacatgacattttgcaaatatctccatgaagttttgcacttatgtgcaaaatgtcctccaaacttaaaaatt |
7978642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 14196004 - 14196080
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||| |||| ||| || |||||||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
T |
14196004 |
aacatgacgttttacaaacatcttcttgaagttttgcacttatgtacaaaatgccccccgaacttgaaaatttatat |
14196080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 17648338 - 17648262
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||| |||||||||||||||||| | ||||| ||||||||||| |
|
|
T |
17648338 |
aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgcctcctgaacttaaaaatttatat |
17648262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 151
Target Start/End: Complemental strand, 21086226 - 21086174
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc |
151 |
Q |
|
|
|||| |||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
T |
21086226 |
aacacgacgttttgcaaatatcctcttaagttttgcacttatgtgcaaaatgc |
21086174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 25751863 - 25751919
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt |
176 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
T |
25751863 |
cccctgaaattttgcacttatgtgcaaaatgtcccctaaacttgaaaatttatattt |
25751919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 6914262 - 6914340
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| | ||| ||||||||| ||||||||||||||| | | ||||||||||||||||||||| |
|
|
T |
6914262 |
aacatgacgttttgcaaata-ctcctaaagttttgcgcttatgtgcaaaatgtctcttgaacttgaaaatttatattttt |
6914340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 96 - 174
Target Start/End: Original strand, 9587642 - 9587721
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||| ||||| |||| | |||||||||| |||| ||||||||||||| ||||||||||||||||| |
|
|
T |
9587642 |
atgaacatgacgttttgtaaatacccccctaaagttttgcatttatatgcaaaatgccccctgaacttgaaaatttatat |
9587721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 17587983 - 17587901
Alignment:
Q |
97 |
tgaacatgacgtttt-gcaaatatcccct--gaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||| |||| ||||||| | |||||||||| |
|
|
T |
17587983 |
tgaacatgacgtttttgcaaataccccctctgaagttttgcacttatgtgcaaaatgcccccccaaacttaataatttatatt |
17587901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 19293203 - 19293128
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| | | | |||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
19293203 |
aacatgacgttttgcaaatacctcattaagttttgcacttatgtgcaaaatatcccctgaacttgaaaatttatat |
19293128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 21640045 - 21640124
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||| ||||||||||||||| |||| |||||||||||||||||||||||||| || | ||||| |||||||||||| |
|
|
T |
21640045 |
tgaacaagacgttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgttccccgaacttaaaaatttatatt |
21640124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 26242912 - 26242990
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| ||||||||||| || || ||||||||||||||| ||||| |||||||||| | ||||| ||||||||||||||| |
|
|
T |
26242912 |
aacatcacgttttgcaattaccctctgaagttttgcactaatgtggaaaatgcccc-cgaacttaaaaatttatattttt |
26242990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 36086238 - 36086183
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||| |||| || |||||||||||||||||||||||||| |
|
|
T |
36086238 |
aacatgacgttttgcaaataccccccaaaattttgcacttatgtgcaaaatgcccc |
36086183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 729488 - 729546
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
729488 |
cccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaatttagattttt |
729546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 10623441 - 10623387
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
T |
10623441 |
cccctgaaattttgcacttatatgcaaaatgccccctaaacttgaaaatttatat |
10623387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 13968761 - 13968707
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
T |
13968761 |
cccctgaaattttgcacttatgtgcaaattgccccctaaacttgaaaatttatat |
13968707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 21362476 - 21362400
Alignment:
Q |
99 |
aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||| |||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
21362476 |
aacatgacgttttgcgaatagctcccctgaagttttt-acttatgtgcaaaatgcccctagaacttgaaaatttatat |
21362400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 25823078 - 25823160
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||||| |||||||||||| | |||||||||||||||||||||| ||||||| || ||| || ||||||||||||||| |
|
|
T |
25823078 |
tgaatatgacattttgcaaatattcacctgaagttttgcacttatgtgtaaaatgctccttaaatttaaaaatttatattttt |
25823160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 29835513 - 29835571
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
29835513 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
29835571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 32294629 - 32294569
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc---ctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||| |
|
|
T |
32294629 |
tgaacatgacgttttgcaaatacccctccctgaagttttgcagttatgtgcaaaatgcccc |
32294569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 36499169 - 36499111
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
36499169 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
36499111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 38091354 - 38091296
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
38091354 |
cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt |
38091296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 40988060 - 40988118
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
40988060 |
cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt |
40988118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 107 - 168
Target Start/End: Original strand, 41084741 - 41084802
Alignment:
Q |
107 |
gttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaat |
168 |
Q |
|
|
|||||||||||| | |||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
T |
41084741 |
gttttgcaaataccaccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaat |
41084802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 4001069 - 4001020
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt |
169 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
4001069 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatt |
4001020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 10622889 - 10622954
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||||||||||| ||||||||||||| |||||| |||||||| |||||| |
|
|
T |
10622889 |
caaataccccctgaaattttgcacttatatgcaaaatgccccctaaacttaaaaatttagattttt |
10622954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 129 - 178
Target Start/End: Original strand, 25525104 - 25525153
Alignment:
Q |
129 |
ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
25525104 |
ttttgcacttatgtgcaaaatgccccataaacttgaaaatttgtattttt |
25525153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 7950922 - 7950999
Alignment:
Q |
99 |
aacatgacgttttgcaaata---tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||| ||||||||||||||||| |
|
|
T |
7950922 |
aacatgacgttt-gcaaataccttcccctgaagttttgcactaatgtgcaaaataccccttgaacttgaaaatttatat |
7950999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 101 - 152
Target Start/End: Original strand, 21360655 - 21360707
Alignment:
Q |
101 |
catgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcc |
152 |
Q |
|
|
|||||| ||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
T |
21360655 |
catgaccttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcc |
21360707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 178
Target Start/End: Complemental strand, 26244071 - 26244000
Alignment:
Q |
107 |
gttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| ||| ||||||| ||||||||||||||||||| |||| | |||||||||||| |||||||| |
|
|
T |
26244071 |
gttttgcaaatacccctctgaagtcttgcacttatgtgcaaaatacccc-cgaacttgaaaattgatattttt |
26244000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 34216990 - 34217066
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| | | ||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
T |
34216990 |
aacatgatgttttgcaaataccgctctgaagttttgcactcatgtgcaaaatgccctctgaacttgaaaatttatat |
34217066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 5382345 - 5382287
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||| |||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
5382345 |
cccctgaaattttgcaattatgtgcaaaatgccccctaaacttaaaaatttagattttt |
5382287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 13968068 - 13968126
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||| ||||||||||| |||||| |||||||| |||||| |
|
|
T |
13968068 |
cccctgaaattttgcacttatgtacaaaatgccccataaacttaaaaatttagattttt |
13968126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 25752891 - 25752833
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||| ||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
25752891 |
cccctgaaattttacacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
25752833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 27500317 - 27500383
Alignment:
Q |
113 |
caaatatcccctgaag-ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| || |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
27500317 |
caaatatccccttaaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
27500383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 29836029 - 29835975
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
T |
29836029 |
cccctgaaattttgcacttatgtgcaaaatgtcccataaatttgaaaatttatat |
29835975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 33159801 - 33159743
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
33159801 |
ccccagaatttttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
33159743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 148
Target Start/End: Complemental strand, 36089811 - 36089761
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaa |
148 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
T |
36089811 |
aacatgacgttttgcaaatacccccccgaagttttgcacttatgtgcaaaa |
36089761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 99 - 151
Target Start/End: Original strand, 21085879 - 21085932
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgc |
151 |
Q |
|
|
|||||||| ||||||||||| || | |||||||||||||||||||||||||||| |
|
|
T |
21085879 |
aacatgacattttgcaaatactctcttgaagttttgcacttatgtgcaaaatgc |
21085932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 99 - 144
Target Start/End: Original strand, 27188064 - 27188109
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgc |
144 |
Q |
|
|
||||||| |||||||||||| ||||| ||||||||||||||||||| |
|
|
T |
27188064 |
aacatgaggttttgcaaataccccctaaagttttgcacttatgtgc |
27188109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 730310 - 730254
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaac-ttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||||||||||||||| |||| || ||||||||||||||| |
|
|
T |
730310 |
ctgaaattttgcacttatgtgcaaaatgccccctaaactttaaaaatttatattttt |
730254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 25455684 - 25455760
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| ||| | |||||||| |||||||||||||||||| | ||||||||||||||||| |
|
|
T |
25455684 |
aacatgatgttttgcaaatacccctcaaaagttttgtacttatgtgcaaaatgccattcgaacttgaaaatttatat |
25455760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #193
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 26662182 - 26662238
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||||||||||||||| | ||||||||||| ||||||||||||||||||||| |
|
|
T |
26662182 |
aacatgacgttttgcaaatgcttccctgaagtttcacacttatgtgcaaaatgcccc |
26662238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #194
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 26933777 - 26933833
Alignment:
Q |
99 |
aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||||||||||||||||| | ||||||||||| ||||||||||||||||||||| |
|
|
T |
26933777 |
aacatgacgttttgcaaatgcttccctgaagtttcacacttatgtgcaaaatgcccc |
26933833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #195
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 120 - 164
Target Start/End: Original strand, 30971363 - 30971407
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga |
164 |
Q |
|
|
||||||||||||||||||||||||| ||||||||| | ||||||| |
|
|
T |
30971363 |
cccctgaagttttgcacttatgtgcgaaatgccccccgaacttga |
30971407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #196
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 126 - 178
Target Start/End: Original strand, 38424264 - 38424316
Alignment:
Q |
126 |
aagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||||| ||| | ||||| ||||||||||||||| |
|
|
T |
38424264 |
aagttttgcacttatgtgcaaaatatccctcgaacttaaaaatttatattttt |
38424316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #197
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 151
Target Start/End: Original strand, 17587368 - 17587423
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgc |
151 |
Q |
|
|
|||||| ||||||||||||||| ||| ||||| ||||||| ||||||||||||||| |
|
|
T |
17587368 |
tgaacaagacgttttgcaaatacccctctgaaattttgcatttatgtgcaaaatgc |
17587423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #198
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 167
Target Start/End: Complemental strand, 25525919 - 25525872
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa |
167 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
T |
25525919 |
cccctgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaa |
25525872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #199
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 123 - 170
Target Start/End: Original strand, 33158973 - 33159019
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
33158973 |
ctgaaattttgcacttatgtgcaaaatgcccc-taaacttgaaaattt |
33159019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #200
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 39048412 - 39048353
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||| |||| |||||| |||||||| |||||| |
|
|
T |
39048412 |
cccctgaaattttgcacttatgtgcaaaatgcccccataaacttaaaaatttagattttt |
39048353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #201
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 747465 - 747407
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||||||||||||||| || | |||| |||||||| |||||| |
|
|
T |
747465 |
cccctgaaattttgcacttatgtgcaaaatgctccctatacttaaaaatttagattttt |
747407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #202
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 2744923 - 2744977
Alignment:
Q |
124 |
tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||| ||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
2744923 |
tgaaattttgcacttatgtgcaaaatgccctataaacttaaaaatttagattttt |
2744977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #203
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 11276707 - 11276761
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||| ||||||||||||||||||||| ||| | || |||||||||||||| |
|
|
T |
11276707 |
cccctgaaattttgcacttatgtgcaaaataccctccgaatttgaaaatttatat |
11276761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #204
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 34217275 - 34217194
Alignment:
Q |
99 |
aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||| |||||||||||| || | | ||||||||||||||||||||||||| || ||||| ||||||||||||||| |
|
|
T |
34217275 |
aacatgatgttttgcaaatacctcacgttaagttttgcacttatgtgcaaaatgtccgttgaacttaaaaatttatattttt |
34217194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #205
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 101 - 178
Target Start/End: Complemental strand, 12853058 - 12852981
Alignment:
Q |
101 |
catgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| || || || || ||||||||||||||| | ||||||||||||||| ||||| |
|
|
T |
12853058 |
catgacgttttgcaaatatccctcgatgtcttccaattatgtgcaaaatgcacattgaacttgaaaatttatgttttt |
12852981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #206
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 154
Target Start/End: Complemental strand, 16868212 - 16868171
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
|||||| |||||||| |||||| ||||||||||||||||||| |
|
|
T |
16868212 |
caaataccccctgaaattttgctcttatgtgcaaaatgcccc |
16868171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #207
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 129 - 174
Target Start/End: Original strand, 39047466 - 39047511
Alignment:
Q |
129 |
ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
T |
39047466 |
ttttgcacttatctgcaaaatgccccctcaacttgaaaatttatat |
39047511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #208
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 13544693 - 13544768
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| |||| ||||||||||| ||||||||| |||| |||| | ||||| ||| ||||||| |
|
|
T |
13544693 |
aacatgatgttttgcaaatacccccttgaagttttgc-cttatgtgcgaaataccccccgaacttaaaagtttatat |
13544768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #209
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 21305973 - 21305917
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||| |||||||||||||| ||| | |||| |||||||||||||||||||| |||| |
|
|
T |
21305973 |
aacatcacgttttgcaaatacccctttgaagatttgcacttatgtgcaaaatccccc |
21305917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #210
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 21313811 - 21313755
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgcccc |
154 |
Q |
|
|
||||| |||||||||||||| ||| | |||| |||||||||||||||||||| |||| |
|
|
T |
21313811 |
aacatcacgttttgcaaatacccctttgaagatttgcacttatgtgcaaaatccccc |
21313755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #211
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 174
Target Start/End: Complemental strand, 25456712 - 25456639
Alignment:
Q |
105 |
acgttttgcaaatatcccc----tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||| ||| |||||||||| |||||||||||||||||| | | || || ||||||||||| |
|
|
T |
25456712 |
acgttttgcaaatataccccccttgaagttttgaacttatgtgcaaaatgccgcccgaatttaaaaatttatat |
25456639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0444 (Bit Score: 64; Significance: 1e-27; HSPs: 2)
Name: scaffold0444
Description:
Target: scaffold0444; HSP #1
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8003 - 7924
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
8003 |
tgaacatgacgttttgcaaatatcctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
7924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0444; HSP #2
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7111 - 7190
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||| ||||||| |||||||||||| |
|
|
T |
7111 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatttgcaaaatgccccccaaacttaaaaatttatatt |
7190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 63; Significance: 4e-27; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41888 - 41810
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||| |||||||||||| |
|
|
T |
41888 |
tgaacatgacgttttgcaaataccccctgaagttttgcacttacgtgcaaaatgccccccaaacttaaaaatttatatt |
41810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 35967 - 36046
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
35967 |
tgaacatgatgttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgccccccaaaattaaaaatttatatt |
36046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41280 - 41359
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
41280 |
tgaacatgatgttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgccccccaaaattaaaaatttatatt |
41359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0083 (Bit Score: 62; Significance: 2e-26; HSPs: 2)
Name: scaffold0083
Description:
Target: scaffold0083; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 177
Target Start/End: Original strand, 3359 - 3440
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
T |
3359 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttatatttt |
3440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0083; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 105 - 175
Target Start/End: Complemental strand, 4694 - 4623
Alignment:
Q |
105 |
acgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| | |||||||||| |
|
|
T |
4694 |
acgttttgcaaatacccccgtgaagttttgcacttatgtgcaaaatgccccctaaacttaataatttatatt |
4623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 60; Significance: 3e-25; HSPs: 5)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7216 - 7295
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
7216 |
tgaacatgacgttttgcaaataccccactgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
7295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7824 - 7745
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
7824 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
7745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #3
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 46646 - 46718
Alignment:
Q |
102 |
atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||||||||||| ||| |||||||||||||||||||||||||| || | | ||||||||||||||||| |
|
|
T |
46646 |
atgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatacctcccgaacttgaaaatttatat |
46718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #4
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 96 - 174
Target Start/End: Original strand, 66719 - 66798
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||| |||||||||||| |||| |||||||||||| |||||||||||| ||||| ||||||| ||||||||||| |
|
|
T |
66719 |
atgaacatgaagttttgcaaatacccccctgaagttttgcatttatgtgcaaaaagccccccaaacttaaaaatttatat |
66798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 67300 - 67224
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||| ||||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
67300 |
aacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgacccctgaacttgaaaatttatat |
67224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 60; Significance: 3e-25; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 12426 - 12505
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
12426 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
12505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13036 - 12956
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
13036 |
tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
12956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 60; Significance: 3e-25; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 185733 - 185812
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
185733 |
tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt |
185812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0572 (Bit Score: 59; Significance: 1e-24; HSPs: 1)
Name: scaffold0572
Description:
Target: scaffold0572; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1687 - 1609
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
1687 |
tgaacattacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
1609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0498 (Bit Score: 59; Significance: 1e-24; HSPs: 2)
Name: scaffold0498
Description:
Target: scaffold0498; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 5318 - 5395
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
5318 |
tgaacatgacgttt-gcaaatatcccctgaagttttgcgcttatgtgcaaaatgccccccaaacttaaaaatttatatt |
5395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0498; HSP #2
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 11311 - 11233
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
11311 |
tgaacatgacattttgtaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
11233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 59; Significance: 1e-24; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 52351 - 52428
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
52351 |
tgaacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt |
52428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 56; Significance: 6e-23; HSPs: 2)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8156 - 8077
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
8156 |
tgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
8077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7548 - 7627
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
T |
7548 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtccc-caaacttaaaaatttatatt |
7627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0945 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: scaffold0945
Description:
Target: scaffold0945; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 2180 - 2102
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
2180 |
tgaacatgacgttttgcaaataatctcctgaagttttgcacttatgtgcaaaatgcccatcgaacttgaaaatttatat |
2102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0945; HSP #2
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 1301 - 1377
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| | || || |||||||||||| |
|
|
T |
1301 |
aacatgacgttttgcaaatatccccctaaagttttgcacttatgtgcaaaatgcccc-cgaagttaaaaatttatatt |
1377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1532 (Bit Score: 54; Significance: 1e-21; HSPs: 1)
Name: scaffold1532
Description:
Target: scaffold1532; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 828 - 748
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||| | ||||||||||||||||||||| |
|
|
T |
828 |
tgaacatgacgttttgcaaata-cccctgaagttttgcacttatatgcaaaataacccccgaacttgaaaatttatattttt |
748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 54; Significance: 1e-21; HSPs: 2)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 102 - 178
Target Start/End: Complemental strand, 13543 - 13467
Alignment:
Q |
102 |
atgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
13543 |
atgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttatattttt |
13467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445; HSP #2
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 12970 - 13049
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || ||||||||| ||||| |
|
|
T |
12970 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaaattaaaaatttatgttttt |
13049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0340 (Bit Score: 54; Significance: 1e-21; HSPs: 2)
Name: scaffold0340
Description:
Target: scaffold0340; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 2349 - 2270
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
2349 |
aacataacgttttgcaaataccccccttgaagttttgcacttatgtgcaaaatgcccc-caaacttgaaaatttatatttt |
2270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0340; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 1438 - 1515
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| || | | |||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
1438 |
aacatgacgttttgcaaatacccacactaaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttatat |
1515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 54; Significance: 1e-21; HSPs: 3)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 94380 - 94457
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||| ||||| | ||||||||||| |
|
|
T |
94380 |
tgaacatgaagttttgcaaataccccctgatgttttgcacttatgtgcaaaatgccccccaaacataaaaatttatat |
94457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 94959 - 94883
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
94959 |
aacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat |
94883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031; HSP #3
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 104460 - 104383
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
104460 |
tgaacatga-gttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt |
104383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 53; Significance: 4e-21; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 96 - 175
Target Start/End: Original strand, 239296 - 239376
Alignment:
Q |
96 |
atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||| || ||||||||| |
|
|
T |
239296 |
atgaacataacgttttgcaaatatccccctgaagttttgcacttatatgcaaaatgccccccaaacttaaatatttatatt |
239376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0343 (Bit Score: 52; Significance: 2e-20; HSPs: 2)
Name: scaffold0343
Description:
Target: scaffold0343; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 10262 - 10340
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| || ||||||||| |
|
|
T |
10262 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaacatttatatt |
10340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0343; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 10868 - 10790
Alignment:
Q |
97 |
tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||| || ||||| |||| ||||| | |||||||||||| |
|
|
T |
10868 |
tgaacatgacgttttgcaaatactcccctgaagttttgcacttatatgtaaaatacccc-caaacataaaaatttatatt |
10790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0320 (Bit Score: 52; Significance: 2e-20; HSPs: 2)
Name: scaffold0320
Description:
Target: scaffold0320; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 15669 - 15748
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| || ||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
T |
15669 |
tgaacatgacgttttgcaaatacccccctaatgttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt |
15748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0320; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 16202 - 16156
Alignment:
Q |
108 |
ttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccc |
153 |
Q |
|
|
||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
T |
16202 |
ttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccc |
16156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 52; Significance: 2e-20; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 22262 - 22341
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||||| ||||| |||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
22262 |
aacatgacgttttgtaaataccccctgaagttttgtacttatgtgcaaaataccccctgaacttgaaaatttatattttt |
22341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 52; Significance: 2e-20; HSPs: 2)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 120762 - 120841
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||| |||||||||||| |||| |||||||||||||||||||| |||||||||| ||||||| |||||||||||| |
|
|
T |
120762 |
tgaacatgatgttttgcaaatacccccatgaagttttgcacttatgtgtaaaatgccccccaaacttaaaaatttatatt |
120841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 121370 - 121292
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||| ||||||| |||||| |||| ||||||||||||||||| |||||||||||| ||||||| |||||||||||| |
|
|
T |
121370 |
tgaacataacgttttacaaataccccccctgaagttttgcacttatatgcaaaatgccc--caaacttaaaaatttatatt |
121292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 52; Significance: 2e-20; HSPs: 4)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 102 - 177
Target Start/End: Complemental strand, 38169 - 38094
Alignment:
Q |
102 |
atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt |
177 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||| | ||||| |||||||| ||||| |
|
|
T |
38169 |
atgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatacccctcgaacttaaaaatttagatttt |
38094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 131039 - 131097
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| ||||||||||||||||| |||||||| |||||| ||||||||||||||| |
|
|
T |
131039 |
cccctgaaattttgcacttatgtgcataatgccccctaaacttaaaaatttatattttt |
131097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 131584 - 131529
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
||||| |||||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
131584 |
ctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt |
131529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 105 - 149
Target Start/End: Original strand, 37817 - 37862
Alignment:
Q |
105 |
acgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaat |
149 |
Q |
|
|
|||||||||| ||| ||||| ||||||||||||||||||||||||| |
|
|
T |
37817 |
acgttttgcagatacccccttgaagttttgcacttatgtgcaaaat |
37862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 77086 - 77165
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
77086 |
tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttacaaatttatatt |
77165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 43366 - 43286
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatccc--ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
43366 |
tgaacatgacgttttgcaaatacccctcctgaagttttacacttatgtgcaaaatgccccccaaagttaaaaatttatatt |
43286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41460 - 41532
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
T |
41460 |
tgaacatgacgttttgcaaatacccccc-----tttgcacttatgtgcaaaatacccc-caaacttaaaaatttatatt |
41532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0132 (Bit Score: 49; Significance: 9e-19; HSPs: 1)
Name: scaffold0132
Description:
Target: scaffold0132; HSP #1
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 42430 - 42354
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| | |||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
42430 |
aacatgacgttttgcaaatacccccctaaagttttgtacttatgtgcaaaatgccccgtgaacttgaaaatttatat |
42354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0287 (Bit Score: 46; Significance: 6e-17; HSPs: 1)
Name: scaffold0287
Description:
Target: scaffold0287; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17406 - 17486
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||| ||||||||||||| || |||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
17406 |
tgaacgtgacgttttgcaagtaccccccctgaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttatatt |
17486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1063 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold1063
Description:
Target: scaffold1063; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 969 - 894
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||| |||| |||| || ||||||||||| |
|
|
T |
969 |
aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatacccc-caaaattaaaaatttatat |
894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1063; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 99 - 151
Target Start/End: Original strand, 389 - 442
Alignment:
Q |
99 |
aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgc |
151 |
Q |
|
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
T |
389 |
aacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgc |
442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 150
Target Start/End: Original strand, 1846 - 1900
Alignment:
Q |
97 |
tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg |
150 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
T |
1846 |
tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg |
1900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 102 - 175
Target Start/End: Original strand, 4509 - 4583
Alignment:
Q |
102 |
atgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||| ||||||||||||| ||| |||||||||||||| ||| | ||||| |||||||||||| |
|
|
T |
4509 |
atgacgttttgcaaatactcccctgaagtttagcagttatgtgcaaaatgtcccccgaactttaaaatttatatt |
4583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 167
Target Start/End: Complemental strand, 5195 - 5127
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa |
167 |
Q |
|
|
||||||||||||| |||||| | ||||||||||||||||||||||||||||| ||| ||||| |||| |
|
|
T |
5195 |
aacatgacgttttacaaatacttcttgaagttttgcacttatgtgcaaaatgcctcgcgaacttaaaaa |
5127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0672 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 2)
Name: scaffold0672
Description:
Target: scaffold0672; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 113 - 171
Target Start/End: Original strand, 5428 - 5486
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta |
171 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||||||| |||||| |||||||| |
|
|
T |
5428 |
caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta |
5486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0672; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 170
Target Start/End: Complemental strand, 6257 - 6207
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt |
170 |
Q |
|
|
||||| || |||||||||||||||||||||||||| |||||| ||||||| |
|
|
T |
6257 |
ccccttaaattttgcacttatgtgcaaaatgccccctaaactttaaaattt |
6207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 2)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 12287 - 12345
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||| ||||||||||| ||||| |
|
|
T |
12287 |
cccctgaaattttgcacttatgtgcaaaatgccccctaaacctgaaaatttattttttt |
12345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 13106 - 13048
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||| |||||||| |||| |||||| |||||||| |||||| |
|
|
T |
13106 |
cccctgaaattttgcacttatttgcaaaataccccctaaacttaaaaatttagattttt |
13048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 59622 - 59543
Alignment:
Q |
96 |
atgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
||||||||||||||||||||||| |||||||| |||| || |||||||||||||||| | |||||| |||||||||||| |
|
|
T |
59622 |
atgaacatgacgttttgcaaatacccccctgaaattttacatttatgtgcaaaatgcctccaaaactt-aaaatttatatt |
59543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214 (Bit Score: 36; Significance: 0.00000000005; HSPs: 2)
Name: scaffold0214
Description:
Target: scaffold0214; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 28649 - 28598
Alignment:
Q |
123 |
ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||| |||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
28649 |
ctgaaattttacacttatgtgcaaaatgccccttaaacttgaaaatttatat |
28598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 16555 - 16500
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt |
175 |
Q |
|
|
|||||||| ||| ||||||| ||||||||||||| ||||||||||||||||||| |
|
|
T |
16555 |
cccctgaaatttgacacttatatgcaaaatgccccctaaacttgaaaatttatatt |
16500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 13535 - 13593
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttg |
179 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||| || |||||||||||||||| |
|
|
T |
13535 |
cccctgaaattttgcacttatgtgcaaaatgccccataaa-tttaaaatttatatttttg |
13593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 36; Significance: 0.00000000005; HSPs: 2)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 42454 - 42395
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttg-aaaatttatattttt |
178 |
Q |
|
|
|||||||| |||||||||||||||||||||||| | ||||||| ||||||||||||||| |
|
|
T |
42454 |
cccctgaaattttgcacttatgtgcaaaatgccacctaaacttgaaaaatttatattttt |
42395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 41625 - 41689
Alignment:
Q |
113 |
caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||| |||||||| |||| || |||||||||||||||||| |||||| |||||||| |||||| |
|
|
T |
41625 |
caaataccccctgaaattttacatttatgtgcaaaatgcccc-taaacttaaaaatttagattttt |
41689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 35024 - 34947
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
||||||| |||||||||||| || | |||||||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
T |
35024 |
aacatgatgttttgcaaataccctccttgaagttttgcacttacgtgcaaaatgcctcctgaacttgaaaatttatat |
34947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 151
Target Start/End: Original strand, 10708 - 10739
Alignment:
Q |
120 |
cccctgaagttttgcacttatgtgcaaaatgc |
151 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
10708 |
cccctgaagttttgcacttatgtgcaaaatgc |
10739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0249 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0249
Description:
Target: scaffold0249; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 24397 - 24473
Alignment:
Q |
99 |
aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat |
174 |
Q |
|
|
|||||||||||||| ||||| ||||| || |||||||||||| |||| ||||||| | ||||||||||||||||| |
|
|
T |
24397 |
aacatgacgttttgtaaatacacccctaaatttttgcacttatctgcacaatgcccttcgaacttgaaaatttatat |
24473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 34223 - 34145
Alignment:
Q |
99 |
aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt |
178 |
Q |
|
|
|||||||||||| ||| |||||||| ||||||| |||||| |||||||||| ||| |||||||||||||||| |||| |
|
|
T |
34223 |
aacatgacgtttaacaagtatcccctaaagttttacacttaagtgcaaaatg-cccttgaacttgaaaatttatactttt |
34145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1624 times since January 2019
Visitors: 2392