View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_high_6 (Length: 583)

Name: NF0214_high_6
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_high_6
NF0214_high_6
[»] chr4 (245 HSPs)
chr4 (97-583)||(4940194-4940666)
chr4 (320-583)||(38350966-38351229)
chr4 (97-320)||(21310950-21311166)
chr4 (320-460)||(21311525-21311665)
chr4 (97-232)||(38350461-38350590)
chr4 (487-583)||(21311662-21311758)
chr4 (96-175)||(32860058-32860137)
chr4 (96-175)||(34476168-34476247)
chr4 (97-175)||(6528322-6528400)
chr4 (97-175)||(24318553-24318631)
chr4 (97-175)||(29246088-29246166)
chr4 (97-175)||(40131149-40131227)
chr4 (97-175)||(6922722-6922801)
chr4 (97-175)||(41744777-41744855)
chr4 (97-174)||(23466274-23466351)
chr4 (98-178)||(55497145-55497225)
chr4 (97-175)||(917907-917986)
chr4 (97-175)||(1617974-1618053)
chr4 (97-175)||(6239004-6239083)
chr4 (97-175)||(6259708-6259787)
chr4 (97-175)||(28255282-28255361)
chr4 (97-175)||(30357142-30357221)
chr4 (97-175)||(32860539-32860618)
chr4 (99-174)||(36111614-36111689)
chr4 (97-175)||(37998136-37998215)
chr4 (97-175)||(37998666-37998745)
chr4 (97-175)||(41790081-41790160)
chr4 (97-175)||(44255261-44255342)
chr4 (97-175)||(50181386-50181465)
chr4 (99-177)||(55083381-55083460)
chr4 (97-175)||(6194255-6194333)
chr4 (97-175)||(6194783-6194861)
chr4 (97-178)||(22535855-22535937)
chr4 (97-174)||(22731721-22731799)
chr4 (99-177)||(36112120-36112197)
chr4 (97-175)||(47838084-47838162)
chr4 (97-175)||(48613973-48614051)
chr4 (97-174)||(56279900-56279978)
chr4 (97-175)||(6259177-6259257)
chr4 (99-178)||(6644154-6644232)
chr4 (97-175)||(17607605-17607685)
chr4 (97-175)||(21659883-21659963)
chr4 (97-175)||(21861352-21861432)
chr4 (97-175)||(21861884-21861964)
chr4 (97-175)||(21917213-21917293)
chr4 (97-175)||(21917745-21917825)
chr4 (97-175)||(27179928-27180008)
chr4 (97-175)||(28255812-28255892)
chr4 (97-175)||(30113944-30114024)
chr4 (99-178)||(12594708-12594788)
chr4 (99-178)||(21857745-21857825)
chr4 (99-178)||(21913608-21913688)
chr4 (97-176)||(23475793-23475873)
chr4 (97-171)||(1195068-1195143)
chr4 (99-178)||(17215825-17215904)
chr4 (97-175)||(18963440-18963519)
chr4 (97-175)||(20598828-20598907)
chr4 (97-175)||(20599357-20599436)
chr4 (99-178)||(22524435-22524513)
chr4 (97-175)||(30288790-30288869)
chr4 (97-175)||(30317692-30317771)
chr4 (97-175)||(32826104-32826183)
chr4 (97-175)||(33821220-33821299)
chr4 (97-175)||(34825330-34825409)
chr4 (103-178)||(38575681-38575755)
chr4 (99-174)||(40145781-40145856)
chr4 (97-175)||(45895500-45895578)
chr4 (97-175)||(48613443-48613522)
chr4 (96-175)||(50605108-50605187)
chr4 (97-178)||(3886035-3886117)
chr4 (97-175)||(13994396-13994474)
chr4 (97-175)||(23465743-23465821)
chr4 (98-175)||(44254784-44254862)
chr4 (97-174)||(9025022-9025099)
chr4 (97-174)||(24792404-24792481)
chr4 (97-174)||(24815780-24815857)
chr4 (97-175)||(34476700-34476780)
chr4 (97-175)||(34824807-34824886)
chr4 (97-175)||(50181916-50181996)
chr4 (99-175)||(51110679-51110756)
chr4 (97-175)||(52346173-52346252)
chr4 (97-178)||(1862010-1862093)
chr4 (99-178)||(12595280-12595360)
chr4 (99-174)||(12800347-12800423)
chr4 (99-178)||(17215070-17215150)
chr4 (98-175)||(17971601-17971680)
chr4 (97-174)||(23475263-23475341)
chr4 (99-178)||(23590612-23590692)
chr4 (96-175)||(26476986-26477066)
chr4 (97-175)||(30356616-30356691)
chr4 (99-178)||(31559787-31559866)
chr4 (99-174)||(34733186-34733262)
chr4 (97-175)||(1195598-1195677)
chr4 (97-175)||(22535329-22535408)
chr4 (97-175)||(22731191-22731270)
chr4 (97-175)||(24317756-24317834)
chr4 (97-175)||(25644786-25644865)
chr4 (97-175)||(27716188-27716266)
chr4 (97-175)||(29245560-29245638)
chr4 (97-175)||(38901485-38901564)
chr4 (97-175)||(41789323-41789401)
chr4 (97-175)||(51110182-51110260)
chr4 (99-174)||(56280404-56280479)
chr4 (107-178)||(56473653-56473724)
chr4 (99-174)||(1614816-1614893)
chr4 (97-170)||(18963976-18964050)
chr4 (97-174)||(34732682-34732760)
chr4 (97-175)||(38902014-38902092)
chr4 (97-175)||(13966831-13966911)
chr4 (97-175)||(13993861-13993945)
chr4 (97-178)||(26763232-26763312)
chr4 (97-175)||(27180459-27180539)
chr4 (101-178)||(29342580-29342657)
chr4 (97-175)||(29761503-29761582)
chr4 (97-173)||(47838746-47838822)
chr4 (99-174)||(6076921-6076997)
chr4 (99-174)||(7389995-7390071)
chr4 (97-152)||(7972840-7972896)
chr4 (99-178)||(23161231-23161311)
chr4 (99-178)||(39333513-39333593)
chr4 (99-174)||(47309094-47309170)
chr4 (97-174)||(48800301-48800380)
chr4 (99-174)||(56443264-56443337)
chr4 (97-175)||(918437-918515)
chr4 (99-178)||(6644804-6644883)
chr4 (97-175)||(13967635-13967714)
chr4 (99-174)||(23161866-23161940)
chr4 (97-175)||(26476460-26476538)
chr4 (99-174)||(29617464-29617539)
chr4 (101-175)||(29762302-29762377)
chr4 (99-150)||(31559167-31559218)
chr4 (99-175)||(37687663-37687740)
chr4 (120-175)||(40132423-40132478)
chr4 (99-174)||(41611356-41611431)
chr4 (97-175)||(42592043-42592122)
chr4 (97-175)||(42593458-42593537)
chr4 (97-175)||(50604578-50604657)
chr4 (99-178)||(55496646-55496724)
chr4 (99-177)||(56444100-56444178)
chr4 (97-154)||(17971110-17971168)
chr4 (97-175)||(24791624-24791702)
chr4 (97-175)||(24816559-24816637)
chr4 (120-178)||(32464951-32465008)
chr4 (99-177)||(42259415-42259493)
chr4 (99-165)||(45764641-45764707)
chr4 (99-154)||(45765568-45765625)
chr4 (120-174)||(47308614-47308668)
chr4 (105-174)||(6507615-6507683)
chr4 (113-178)||(19170219-19170284)
chr4 (102-178)||(25705401-25705478)
chr4 (97-159)||(26171811-26171875)
chr4 (113-174)||(42987938-42987999)
chr4 (99-175)||(52177265-52177344)
chr4 (99-174)||(21858367-21858443)
chr4 (99-174)||(21914230-21914306)
chr4 (101-174)||(29860954-29861029)
chr4 (102-154)||(35194790-35194842)
chr4 (99-178)||(48083079-48083159)
chr4 (97-172)||(1618506-1618580)
chr4 (99-174)||(7862002-7862077)
chr4 (97-175)||(9024717-9024796)
chr4 (99-154)||(9360440-9360495)
chr4 (97-178)||(21312073-21312153)
chr4 (99-174)||(36870234-36870307)
chr4 (99-154)||(36870879-36870934)
chr4 (99-154)||(37302508-37302563)
chr4 (99-178)||(48083896-48083975)
chr4 (99-174)||(48799796-48799870)
chr4 (99-174)||(1861509-1861586)
chr4 (99-174)||(23519455-23519534)
chr4 (105-174)||(25705986-25706056)
chr4 (99-153)||(29616853-29616907)
chr4 (99-174)||(29860065-29860142)
chr4 (97-175)||(30318401-30318479)
chr4 (120-178)||(36927576-36927634)
chr4 (120-178)||(38392184-38392242)
chr4 (120-178)||(39633467-39633525)
chr4 (120-178)||(40278402-40278460)
chr4 (99-172)||(29798037-29798109)
chr4 (97-154)||(30289519-30289576)
chr4 (120-177)||(36076691-36076748)
chr4 (113-178)||(38035671-38035736)
chr4 (109-178)||(40220742-40220810)
chr4 (99-174)||(1613581-1613657)
chr4 (99-174)||(6336946-6337022)
chr4 (103-174)||(9359727-9359799)
chr4 (97-175)||(15030956-15031033)
chr4 (99-154)||(26172323-26172379)
chr4 (99-150)||(39334324-39334376)
chr4 (99-174)||(15739577-15739651)
chr4 (102-154)||(25490128-25490182)
chr4 (97-175)||(32825564-32825643)
chr4 (102-174)||(42260192-42260266)
chr4 (99-174)||(43420662-43420737)
chr4 (99-178)||(44097792-44097870)
chr4 (123-178)||(54283975-54284030)
chr4 (99-175)||(4630660-4630738)
chr4 (97-178)||(4940987-4941069)
chr4 (101-174)||(7862817-7862891)
chr4 (120-178)||(36077155-36077213)
chr4 (120-178)||(36928341-36928399)
chr4 (120-174)||(40034254-40034308)
chr4 (120-178)||(40279158-40279216)
chr4 (120-174)||(41904617-41904671)
chr4 (120-178)||(42341856-42341914)
chr4 (99-174)||(55082568-55082645)
chr4 (119-172)||(1565832-1565885)
chr4 (102-178)||(22072752-22072828)
chr4 (99-178)||(12213278-12213358)
chr4 (120-168)||(19538372-19538420)
chr4 (122-174)||(23519974-23520026)
chr4 (99-154)||(53139872-53139928)
chr4 (99-161)||(6508374-6508437)
chr4 (97-178)||(10663651-10663733)
chr4 (97-178)||(10877796-10877878)
chr4 (120-178)||(19537877-19537935)
chr4 (120-174)||(30779079-30779133)
chr4 (120-178)||(34016953-34017011)
chr4 (97-150)||(38351574-38351628)
chr4 (120-178)||(39632708-39632766)
chr4 (97-154)||(40146296-40146354)
chr4 (121-178)||(6955700-6955757)
chr4 (101-174)||(23395965-23396037)
chr4 (113-178)||(38035162-38035227)
chr4 (113-178)||(38392950-38393015)
chr4 (97-148)||(7972029-7972081)
chr4 (106-178)||(55778126-55778198)
chr4 (106-178)||(55842306-55842378)
chr4 (99-135)||(56473717-56473753)
chr4 (120-178)||(205069-205128)
chr4 (120-171)||(1565099-1565150)
chr4 (120-167)||(6450251-6450298)
chr4 (120-167)||(19169452-19169499)
chr4 (100-174)||(43419716-43419787)
chr4 (120-174)||(220720-220774)
chr4 (112-174)||(33617484-33617546)
chr4 (99-174)||(35194149-35194226)
chr4 (120-154)||(40033483-40033517)
chr4 (120-178)||(42342484-42342542)
chr4 (124-178)||(54445449-54445503)
chr4 (120-153)||(6956186-6956219)
chr4 (125-174)||(32465469-32465518)
chr4 (107-171)||(41610682-41610746)
chr4 (119-178)||(41904123-41904183)
chr4 (114-178)||(42987160-42987224)
[»] chr3 (235 HSPs)
chr3 (320-583)||(40125828-40126094)
chr3 (174-309)||(40126446-40126571)
chr3 (97-175)||(39669457-39669535)
chr3 (97-175)||(43727687-43727765)
chr3 (97-175)||(35154026-35154104)
chr3 (97-175)||(36027905-36027982)
chr3 (97-175)||(13737624-13737704)
chr3 (97-175)||(31585957-31586037)
chr3 (97-176)||(9718048-9718128)
chr3 (97-175)||(883510-883589)
chr3 (97-175)||(884040-884119)
chr3 (97-175)||(3370669-3370748)
chr3 (97-175)||(10120567-10120646)
chr3 (97-175)||(13341729-13341808)
chr3 (97-175)||(17053294-17053373)
chr3 (97-175)||(20495436-20495515)
chr3 (97-175)||(23323873-23323952)
chr3 (97-175)||(23781668-23781747)
chr3 (97-175)||(24828154-24828233)
chr3 (97-175)||(32950889-32950968)
chr3 (97-175)||(44518388-44518467)
chr3 (97-175)||(52171592-52171671)
chr3 (97-174)||(23323342-23323420)
chr3 (97-175)||(36260033-36260111)
chr3 (97-175)||(36736010-36736088)
chr3 (97-175)||(37704250-37704328)
chr3 (97-175)||(40783315-40783393)
chr3 (97-175)||(42248867-42248945)
chr3 (97-175)||(44518918-44518996)
chr3 (99-177)||(54602262-54602340)
chr3 (97-175)||(5152507-5152587)
chr3 (97-174)||(9103878-9103955)
chr3 (97-175)||(23581856-23581936)
chr3 (97-175)||(24086757-24086837)
chr3 (97-175)||(36736539-36736619)
chr3 (99-178)||(11652989-11653069)
chr3 (99-178)||(50672496-50672576)
chr3 (97-175)||(4238251-4238329)
chr3 (97-175)||(13342259-13342338)
chr3 (97-175)||(23908482-23908561)
chr3 (97-175)||(25067677-25067756)
chr3 (97-175)||(31582727-31582806)
chr3 (97-175)||(31586491-31586570)
chr3 (99-175)||(36027106-36027184)
chr3 (97-175)||(39668924-39669002)
chr3 (97-175)||(40163171-40163250)
chr3 (97-175)||(42390040-42390118)
chr3 (97-175)||(47799127-47799206)
chr3 (97-175)||(47799652-47799730)
chr3 (97-175)||(49255783-49255862)
chr3 (97-175)||(49256313-49256392)
chr3 (97-175)||(52171064-52171143)
chr3 (97-175)||(55153486-55153565)
chr3 (97-175)||(55154016-55154095)
chr3 (97-175)||(18073812-18073890)
chr3 (97-175)||(33305831-33305909)
chr3 (97-178)||(52394554-52394636)
chr3 (99-177)||(54627160-54627238)
chr3 (102-178)||(7580456-7580532)
chr3 (103-175)||(10656218-10656291)
chr3 (97-175)||(10657038-10657117)
chr3 (97-175)||(29006776-29006856)
chr3 (97-175)||(38599000-38599080)
chr3 (99-177)||(40065621-40065701)
chr3 (99-175)||(53178376-53178453)
chr3 (99-174)||(14509309-14509385)
chr3 (99-175)||(24782223-24782299)
chr3 (99-174)||(26839291-26839366)
chr3 (97-172)||(42855876-42855952)
chr3 (99-178)||(54492852-54492932)
chr3 (103-170)||(1033720-1033787)
chr3 (97-175)||(10120036-10120114)
chr3 (97-175)||(23781138-23781217)
chr3 (97-175)||(24814208-24814286)
chr3 (96-179)||(26839403-26839486)
chr3 (97-175)||(36791636-36791715)
chr3 (97-175)||(42389511-42389590)
chr3 (97-175)||(46976741-46976820)
chr3 (97-175)||(49527845-49527924)
chr3 (99-178)||(55482242-55482320)
chr3 (97-174)||(4584135-4584213)
chr3 (97-175)||(5153041-5153119)
chr3 (100-175)||(6071110-6071187)
chr3 (97-175)||(19238346-19238424)
chr3 (97-175)||(19961647-19961724)
chr3 (97-175)||(20495968-20496046)
chr3 (99-178)||(31584819-31584900)
chr3 (97-170)||(34503538-34503612)
chr3 (97-175)||(35154555-35154633)
chr3 (97-172)||(38599534-38599610)
chr3 (97-175)||(23909012-23909092)
chr3 (97-175)||(24086226-24086306)
chr3 (97-175)||(31583257-31583337)
chr3 (97-175)||(43727157-43727237)
chr3 (97-174)||(52961049-52961125)
chr3 (97-175)||(53628113-53628193)
chr3 (103-174)||(8014742-8014814)
chr3 (99-174)||(35234976-35235052)
chr3 (97-175)||(13737088-13737167)
chr3 (97-175)||(20186535-20186613)
chr3 (97-175)||(21627928-21628007)
chr3 (97-175)||(33305287-33305365)
chr3 (99-150)||(34921424-34921475)
chr3 (99-177)||(35235815-35235894)
chr3 (97-175)||(36259504-36259583)
chr3 (97-175)||(40514823-40514901)
chr3 (97-175)||(45258595-45258674)
chr3 (97-175)||(19239828-19239906)
chr3 (97-175)||(24376775-24376853)
chr3 (99-178)||(35234686-35234766)
chr3 (120-178)||(38667271-38667329)
chr3 (99-174)||(40791484-40791563)
chr3 (97-175)||(42248072-42248149)
chr3 (99-174)||(42856676-42856753)
chr3 (99-175)||(9718578-9718654)
chr3 (97-154)||(11653717-11653774)
chr3 (98-162)||(29006659-29006724)
chr3 (97-175)||(34941575-34941655)
chr3 (99-175)||(53627316-53627392)
chr3 (97-168)||(987265-987337)
chr3 (99-174)||(20819355-20819431)
chr3 (99-178)||(29588945-29589024)
chr3 (99-174)||(32751662-32751738)
chr3 (99-174)||(40066465-40066541)
chr3 (99-175)||(44405260-44405335)
chr3 (99-174)||(54603101-54603177)
chr3 (99-176)||(55481472-55481551)
chr3 (113-172)||(1586977-1587036)
chr3 (99-174)||(2445123-2445198)
chr3 (97-175)||(6071650-6071731)
chr3 (97-175)||(20189429-20189508)
chr3 (97-175)||(38771685-38771764)
chr3 (97-175)||(40782787-40782865)
chr3 (99-178)||(41222559-41222638)
chr3 (97-174)||(42803059-42803137)
chr3 (99-150)||(45712546-45712597)
chr3 (120-175)||(52961574-52961628)
chr3 (99-174)||(54801149-54801224)
chr3 (120-178)||(3021220-3021278)
chr3 (120-178)||(3937725-3937783)
chr3 (120-178)||(4070400-4070458)
chr3 (99-178)||(7579943-7580024)
chr3 (124-178)||(14899338-14899392)
chr3 (102-175)||(21627403-21627477)
chr3 (97-154)||(25068239-25068297)
chr3 (99-169)||(31585201-31585270)
chr3 (120-178)||(36951786-36951844)
chr3 (99-178)||(40009443-40009524)
chr3 (120-174)||(49316193-49316247)
chr3 (97-150)||(52395062-52395116)
chr3 (113-178)||(10473691-10473756)
chr3 (113-178)||(33982044-33982109)
chr3 (99-175)||(37703723-37703799)
chr3 (113-178)||(43354440-43354505)
chr3 (97-175)||(45257965-45258044)
chr3 (99-174)||(1092147-1092223)
chr3 (99-172)||(4490279-4490354)
chr3 (99-174)||(24783057-24783133)
chr3 (99-174)||(32750817-32750893)
chr3 (107-178)||(37332741-37332813)
chr3 (122-174)||(39285073-39285125)
chr3 (99-178)||(40792273-40792353)
chr3 (99-150)||(46651077-46651129)
chr3 (99-150)||(9103383-9103434)
chr3 (107-178)||(34922033-34922103)
chr3 (99-174)||(35233874-35233949)
chr3 (123-178)||(45148944-45148999)
chr3 (99-154)||(50314352-50314407)
chr3 (100-178)||(54493537-54493616)
chr3 (120-178)||(1587753-1587811)
chr3 (124-178)||(22847792-22847846)
chr3 (120-178)||(38667709-38667767)
chr3 (97-175)||(38770432-38770508)
chr3 (120-174)||(40278263-40278317)
chr3 (124-174)||(43914601-43914651)
chr3 (97-175)||(46975973-46976049)
chr3 (120-178)||(49316680-49316738)
chr3 (97-175)||(55117099-55117176)
chr3 (126-175)||(987845-987894)
chr3 (113-178)||(13268585-13268650)
chr3 (97-153)||(39172419-39172476)
chr3 (99-174)||(9667205-9667281)
chr3 (107-174)||(29587242-29587309)
chr3 (99-151)||(30835109-30835161)
chr3 (103-154)||(40010076-40010128)
chr3 (122-178)||(40279050-40279106)
chr3 (99-175)||(42802131-42802206)
chr3 (98-178)||(49223572-49223652)
chr3 (99-143)||(53757852-53757895)
chr3 (99-178)||(54800199-54800279)
chr3 (115-174)||(17753960-17754019)
chr3 (115-174)||(19055280-19055339)
chr3 (120-171)||(21414445-21414496)
chr3 (119-178)||(26034964-26035022)
chr3 (99-174)||(33129200-33129274)
chr3 (123-178)||(39285274-39285329)
chr3 (198-293)||(40138596-40138685)
chr3 (99-178)||(54627994-54628076)
chr3 (120-178)||(3022110-3022168)
chr3 (120-178)||(4069940-4069998)
chr3 (124-178)||(13269079-13269133)
chr3 (120-178)||(14898882-14898940)
chr3 (120-178)||(22847030-22847087)
chr3 (120-178)||(27656166-27656224)
chr3 (124-178)||(29492161-29492214)
chr3 (99-174)||(33128546-33128623)
chr3 (120-174)||(33981551-33981605)
chr3 (99-152)||(37117073-37117127)
chr3 (97-175)||(40512471-40512548)
chr3 (120-178)||(45969478-45969536)
chr3 (99-167)||(9665627-9665696)
chr3 (113-178)||(33777658-33777722)
chr3 (129-178)||(45149701-45149750)
chr3 (99-174)||(8015516-8015592)
chr3 (119-178)||(43353690-43353750)
chr3 (98-150)||(49223349-49223401)
chr3 (124-167)||(21576698-21576741)
chr3 (107-178)||(35547103-35547174)
chr3 (120-178)||(33237674-33237732)
chr3 (120-178)||(37090376-37090434)
chr3 (120-178)||(43913831-43913889)
chr3 (113-178)||(17754734-17754799)
chr3 (113-178)||(19056054-19056119)
chr3 (120-153)||(21414670-21414703)
chr3 (99-148)||(25360242-25360291)
chr3 (97-139)||(36791173-36791217)
chr3 (123-164)||(37089623-37089664)
chr3 (124-169)||(53082076-53082121)
chr3 (99-154)||(17571759-17571817)
chr3 (99-174)||(20411102-20411178)
chr3 (124-175)||(21197095-21197144)
chr3 (142-178)||(23336197-23336233)
chr3 (99-174)||(41221820-41221896)
chr3 (120-164)||(45970632-45970676)
chr3 (114-154)||(50314320-50314360)
[»] chr2 (135 HSPs)
chr2 (97-221)||(3362824-3362948)
chr2 (97-178)||(26367990-26368071)
chr2 (97-175)||(1550115-1550193)
chr2 (97-175)||(25774932-25775010)
chr2 (96-175)||(41799863-41799943)
chr2 (97-175)||(40651415-40651494)
chr2 (97-175)||(12178593-12178671)
chr2 (97-175)||(16057406-16057483)
chr2 (97-178)||(28243276-28243358)
chr2 (97-175)||(44258121-44258198)
chr2 (97-175)||(4356835-4356915)
chr2 (99-178)||(15830822-15830902)
chr2 (99-178)||(35059108-35059188)
chr2 (97-175)||(122143-122222)
chr2 (97-175)||(12178063-12178142)
chr2 (97-175)||(19223528-19223607)
chr2 (99-174)||(22064541-22064616)
chr2 (97-175)||(25775452-25775531)
chr2 (97-175)||(25991995-25992073)
chr2 (97-175)||(37224590-37224669)
chr2 (97-175)||(38964785-38964864)
chr2 (99-178)||(39939410-39939489)
chr2 (97-175)||(40598553-40598632)
chr2 (97-175)||(40650885-40650964)
chr2 (97-175)||(4357367-4357445)
chr2 (97-175)||(32892232-32892310)
chr2 (97-175)||(32892761-32892839)
chr2 (97-174)||(39500906-39500984)
chr2 (97-175)||(3434574-3434654)
chr2 (97-175)||(22487267-22487347)
chr2 (97-175)||(41799332-41799412)
chr2 (97-175)||(121614-121692)
chr2 (99-175)||(1550616-1550694)
chr2 (99-174)||(7532041-7532115)
chr2 (99-177)||(9708004-9708083)
chr2 (99-178)||(12138621-12138700)
chr2 (99-174)||(17816114-17816189)
chr2 (97-175)||(22481969-22482048)
chr2 (97-175)||(26367463-26367542)
chr2 (97-175)||(28242748-28242826)
chr2 (97-175)||(33869760-33869839)
chr2 (97-175)||(36566372-36566451)
chr2 (97-175)||(2695745-2695825)
chr2 (99-175)||(5440230-5440307)
chr2 (97-175)||(8345896-8345976)
chr2 (98-175)||(3074872-3074951)
chr2 (99-174)||(7275514-7275590)
chr2 (99-178)||(21540439-21540519)
chr2 (97-175)||(42793675-42793755)
chr2 (97-175)||(45630054-45630134)
chr2 (99-162)||(3910330-3910393)
chr2 (97-175)||(6166316-6166395)
chr2 (97-175)||(8346421-8346500)
chr2 (97-175)||(13700417-13700496)
chr2 (97-175)||(16057934-16058012)
chr2 (97-175)||(19222999-19223077)
chr2 (97-175)||(33008379-33008457)
chr2 (99-178)||(36207107-36207186)
chr2 (107-174)||(38935863-38935930)
chr2 (97-175)||(42793146-42793224)
chr2 (108-174)||(4646038-4646104)
chr2 (97-174)||(28637993-28638071)
chr2 (97-175)||(44747873-44747951)
chr2 (97-154)||(3435081-3435138)
chr2 (99-174)||(1091242-1091318)
chr2 (99-178)||(3106284-3106364)
chr2 (99-174)||(3106954-3107030)
chr2 (99-178)||(4646932-4647012)
chr2 (99-178)||(5606926-5607006)
chr2 (99-178)||(9708852-9708932)
chr2 (99-178)||(14251994-14252074)
chr2 (99-178)||(20207163-20207243)
chr2 (97-174)||(22064036-22064115)
chr2 (97-175)||(6166846-6166924)
chr2 (97-175)||(7778403-7778482)
chr2 (99-178)||(21545247-21545326)
chr2 (98-175)||(37225111-37225192)
chr2 (97-154)||(3074380-3074438)
chr2 (98-175)||(7777595-7777673)
chr2 (97-174)||(17815597-17815674)
chr2 (102-178)||(35058321-35058397)
chr2 (102-178)||(41425552-41425629)
chr2 (99-174)||(7338735-7338811)
chr2 (99-178)||(34925942-34926022)
chr2 (97-175)||(33437882-33437960)
chr2 (99-174)||(7277908-7277985)
chr2 (120-178)||(10574978-10575036)
chr2 (97-178)||(11871270-11871351)
chr2 (113-178)||(17540264-17540330)
chr2 (99-174)||(23849083-23849160)
chr2 (120-178)||(27482173-27482231)
chr2 (120-178)||(41726997-41727055)
chr2 (120-178)||(45159740-45159798)
chr2 (113-178)||(29365948-29366013)
chr2 (105-174)||(36207936-36208005)
chr2 (99-174)||(8307338-8307414)
chr2 (99-174)||(20463574-20463650)
chr2 (97-174)||(7532540-7532618)
chr2 (113-176)||(45160233-45160296)
chr2 (120-178)||(5438935-5438993)
chr2 (120-178)||(6082191-6082249)
chr2 (120-174)||(18060409-18060463)
chr2 (120-178)||(28150786-28150844)
chr2 (99-166)||(28636238-28636307)
chr2 (120-178)||(41287209-41287267)
chr2 (120-178)||(43208934-43208992)
chr2 (102-174)||(7337915-7337988)
chr2 (99-174)||(12139245-12139321)
chr2 (99-174)||(39500402-39500478)
chr2 (120-176)||(43207005-43207061)
chr2 (99-174)||(5607437-5607512)
chr2 (99-178)||(20207687-20207765)
chr2 (120-178)||(28150021-28150080)
chr2 (120-175)||(28586967-28587022)
chr2 (99-174)||(38939147-38939222)
chr2 (97-178)||(3363936-3364018)
chr2 (102-152)||(9759038-9759087)
chr2 (97-175)||(11865515-11865591)
chr2 (120-178)||(18059635-18059693)
chr2 (120-178)||(29366441-29366499)
chr2 (97-175)||(2695006-2695075)
chr2 (129-178)||(6081120-6081169)
chr2 (99-151)||(9758419-9758472)
chr2 (134-175)||(44258648-44258689)
chr2 (96-172)||(44747081-44747157)
chr2 (96-136)||(33437341-33437381)
chr2 (120-159)||(28636578-28636617)
chr2 (120-178)||(41286436-41286495)
chr2 (120-178)||(27481412-27481470)
chr2 (120-178)||(28587467-28587525)
chr2 (130-175)||(33437385-33437431)
chr2 (99-150)||(7278207-7278260)
chr2 (99-147)||(36208035-36208084)
chr2 (126-154)||(1090669-1090697)
chr2 (99-139)||(28780300-28780339)
[»] chr7 (204 HSPs)
chr7 (97-178)||(40245992-40246073)
chr7 (97-175)||(30838548-30838626)
chr7 (97-175)||(39628509-39628587)
chr7 (97-175)||(39628850-39628928)
chr7 (97-175)||(44335281-44335359)
chr7 (97-178)||(21176095-21176176)
chr7 (100-175)||(3628074-3628149)
chr7 (97-175)||(35500497-35500576)
chr7 (97-175)||(36644167-36644246)
chr7 (97-175)||(43774659-43774738)
chr7 (97-175)||(37231317-37231395)
chr7 (97-175)||(41080926-41081004)
chr7 (97-175)||(46230114-46230191)
chr7 (97-175)||(10463869-10463948)
chr7 (97-175)||(17271917-17271996)
chr7 (99-178)||(21459388-21459466)
chr7 (97-175)||(26303418-26303497)
chr7 (97-175)||(28290142-28290221)
chr7 (97-175)||(40668059-40668138)
chr7 (97-175)||(44335810-44335889)
chr7 (97-175)||(44744393-44744472)
chr7 (97-175)||(46100790-46100869)
chr7 (99-174)||(46949560-46949634)
chr7 (97-175)||(21176622-21176700)
chr7 (97-175)||(35004324-35004401)
chr7 (97-175)||(35788290-35788367)
chr7 (97-175)||(39403445-39403522)
chr7 (97-175)||(42029117-42029194)
chr7 (97-175)||(43670725-43670802)
chr7 (97-175)||(43775447-43775524)
chr7 (97-178)||(44388294-44388376)
chr7 (97-175)||(7337817-7337897)
chr7 (97-175)||(34994575-34994655)
chr7 (99-175)||(44744924-44745001)
chr7 (97-175)||(45155044-45155124)
chr7 (97-175)||(45155575-45155655)
chr7 (97-176)||(18928218-18928298)
chr7 (97-175)||(6804812-6804891)
chr7 (97-175)||(8641033-8641112)
chr7 (97-175)||(8641563-8641641)
chr7 (97-175)||(17272447-17272526)
chr7 (97-175)||(18121346-18121424)
chr7 (99-178)||(21458743-21458822)
chr7 (97-175)||(34962508-34962586)
chr7 (97-175)||(34963032-34963111)
chr7 (97-175)||(34993776-34993855)
chr7 (97-175)||(36787302-36787381)
chr7 (97-175)||(37007722-37007801)
chr7 (97-175)||(38171559-38171638)
chr7 (97-175)||(38354105-38354184)
chr7 (101-175)||(38354635-38354710)
chr7 (97-175)||(43082389-43082467)
chr7 (97-175)||(47170853-47170932)
chr7 (98-175)||(18031613-18031691)
chr7 (97-175)||(36786774-36786851)
chr7 (97-175)||(39402917-39402994)
chr7 (97-174)||(44781852-44781930)
chr7 (97-175)||(7462841-7462921)
chr7 (97-175)||(38171035-38171115)
chr7 (99-178)||(23678760-23678840)
chr7 (98-173)||(40245197-40245273)
chr7 (104-175)||(43671530-43671602)
chr7 (97-175)||(7337298-7337377)
chr7 (99-177)||(14102952-14103031)
chr7 (99-177)||(14412969-14413048)
chr7 (97-175)||(17897166-17897245)
chr7 (97-175)||(18031081-18031160)
chr7 (97-175)||(19488716-19488794)
chr7 (102-178)||(24213261-24213339)
chr7 (99-174)||(26928208-26928283)
chr7 (97-175)||(41409007-41409086)
chr7 (97-175)||(46100260-46100339)
chr7 (98-173)||(11455553-11455630)
chr7 (99-178)||(29418018-29418099)
chr7 (97-175)||(35004852-35004928)
chr7 (97-154)||(36709397-36709455)
chr7 (97-175)||(6804010-6804090)
chr7 (101-178)||(8124862-8124939)
chr7 (97-175)||(24182540-24182620)
chr7 (97-162)||(26342731-26342796)
chr7 (99-173)||(30162546-30162622)
chr7 (113-178)||(34345372-34345437)
chr7 (97-175)||(41409477-41409557)
chr7 (97-173)||(41642146-41642223)
chr7 (99-177)||(43759622-43759702)
chr7 (99-152)||(44950629-44950682)
chr7 (99-175)||(48936291-48936368)
chr7 (97-178)||(22114003-22114086)
chr7 (99-174)||(24212441-24212517)
chr7 (99-174)||(26831664-26831740)
chr7 (99-178)||(29417259-29417339)
chr7 (99-174)||(33697231-33697307)
chr7 (97-178)||(40525355-40525438)
chr7 (107-178)||(4288239-4288310)
chr7 (99-178)||(5211119-5211197)
chr7 (99-174)||(18829198-18829273)
chr7 (97-175)||(23379059-23379137)
chr7 (97-175)||(24182009-24182088)
chr7 (97-175)||(24466434-24466513)
chr7 (99-177)||(26832508-26832587)
chr7 (97-175)||(30890346-30890425)
chr7 (107-174)||(31309290-31309357)
chr7 (99-174)||(34959043-34959118)
chr7 (99-174)||(36897527-36897602)
chr7 (119-178)||(38184330-38184389)
chr7 (97-164)||(40524715-40524782)
chr7 (108-175)||(40668589-40668655)
chr7 (97-175)||(41080397-41080475)
chr7 (97-175)||(42028586-42028665)
chr7 (99-154)||(48611196-48611251)
chr7 (97-175)||(48937089-48937167)
chr7 (105-174)||(4287071-4287141)
chr7 (97-174)||(7462035-7462110)
chr7 (105-178)||(31308379-31308452)
chr7 (99-177)||(36900645-36900726)
chr7 (99-174)||(45259537-45259614)
chr7 (99-174)||(48610762-48610839)
chr7 (97-175)||(3628599-3628679)
chr7 (121-178)||(19072072-19072129)
chr7 (113-178)||(48343718-48343783)
chr7 (104-175)||(1730137-1730209)
chr7 (108-175)||(24646779-24646847)
chr7 (99-174)||(30023141-30023217)
chr7 (99-170)||(35499240-35499312)
chr7 (97-154)||(40341111-40341170)
chr7 (99-174)||(44378927-44379005)
chr7 (99-174)||(44387794-44387872)
chr7 (97-175)||(2755910-2755989)
chr7 (102-174)||(17774427-17774501)
chr7 (107-174)||(21124956-21125023)
chr7 (123-178)||(21366403-21366458)
chr7 (107-174)||(33227811-33227878)
chr7 (97-175)||(37007190-37007268)
chr7 (97-175)||(45856920-45856999)
chr7 (108-154)||(1493704-1493750)
chr7 (99-154)||(21125585-21125642)
chr7 (97-154)||(35498754-35498812)
chr7 (97-178)||(44472710-44472792)
chr7 (97-175)||(46229577-46229662)
chr7 (97-175)||(22599375-22599455)
chr7 (97-153)||(26931423-26931480)
chr7 (97-175)||(47170319-47170402)
chr7 (99-174)||(5198364-5198440)
chr7 (120-175)||(12231270-12231326)
chr7 (97-175)||(26931950-26932033)
chr7 (99-174)||(29644889-29644965)
chr7 (99-174)||(33228467-33228543)
chr7 (99-174)||(33696623-33696699)
chr7 (123-178)||(8296385-8296440)
chr7 (119-174)||(16083138-16083193)
chr7 (97-175)||(18120383-18120462)
chr7 (99-174)||(18830123-18830197)
chr7 (113-171)||(12231909-12231967)
chr7 (99-178)||(15752357-15752438)
chr7 (102-167)||(17775210-17775276)
chr7 (120-178)||(19071598-19071656)
chr7 (120-178)||(28294397-28294455)
chr7 (120-178)||(28311642-28311700)
chr7 (120-178)||(35667918-35667976)
chr7 (120-178)||(39767472-39767530)
chr7 (124-174)||(45259058-45259108)
chr7 (97-149)||(5852433-5852486)
chr7 (113-166)||(9494951-9495004)
chr7 (102-178)||(9495589-9495662)
chr7 (97-175)||(11456352-11456432)
chr7 (120-169)||(37710695-37710744)
chr7 (113-178)||(40260488-40260553)
chr7 (113-178)||(41798447-41798512)
chr7 (99-174)||(22992099-22992174)
chr7 (99-154)||(27316310-27316366)
chr7 (102-178)||(42260819-42260895)
chr7 (99-174)||(22022881-22022956)
chr7 (99-174)||(30163392-30163467)
chr7 (123-174)||(33210419-33210470)
chr7 (99-149)||(34486778-34486829)
chr7 (112-174)||(44157603-44157666)
chr7 (120-170)||(4236277-4236327)
chr7 (120-178)||(4237043-4237101)
chr7 (120-178)||(16083654-16083712)
chr7 (97-174)||(22598914-22598991)
chr7 (124-178)||(37711188-37711242)
chr7 (120-178)||(38184818-38184876)
chr7 (120-174)||(38449965-38450019)
chr7 (113-178)||(38450600-38450666)
chr7 (120-178)||(39880653-39880711)
chr7 (113-174)||(34345846-34345907)
chr7 (129-178)||(35668406-35668455)
chr7 (113-154)||(39880164-39880205)
chr7 (113-178)||(48344214-48344279)
chr7 (120-176)||(39766980-39767036)
chr7 (99-174)||(42491341-42491417)
chr7 (99-174)||(14103794-14103871)
chr7 (99-174)||(14413811-14413888)
chr7 (99-178)||(15753201-15753279)
chr7 (104-151)||(19557437-19557484)
chr7 (120-167)||(28312420-28312467)
chr7 (120-154)||(14313050-14313084)
chr7 (120-178)||(14313553-14313611)
chr7 (103-152)||(21387150-21387200)
chr7 (97-134)||(24646297-24646335)
chr7 (120-165)||(28293530-28293575)
chr7 (120-152)||(10546558-10546590)
chr7 (105-144)||(17897974-17898014)
chr7 (99-150)||(44679101-44679153)
[»] scaffold0196 (1 HSPs)
scaffold0196 (97-178)||(6494-6575)
[»] chr8 (189 HSPs)
chr8 (98-178)||(29119751-29119831)
chr8 (97-175)||(14244401-14244479)
chr8 (97-175)||(14450633-14450711)
chr8 (97-175)||(29119222-29119300)
chr8 (99-175)||(9737030-9737106)
chr8 (97-175)||(10443193-10443272)
chr8 (97-175)||(15731491-15731570)
chr8 (97-175)||(15732022-15732101)
chr8 (97-175)||(18809704-18809783)
chr8 (96-175)||(40520833-40520912)
chr8 (97-175)||(1077322-1077399)
chr8 (97-175)||(1587984-1588062)
chr8 (97-175)||(7723260-7723338)
chr8 (97-175)||(7723788-7723866)
chr8 (97-175)||(9116130-9116208)
chr8 (97-175)||(36508392-36508470)
chr8 (97-175)||(43433566-43433643)
chr8 (97-175)||(43924212-43924290)
chr8 (97-178)||(35771641-35771721)
chr8 (97-176)||(43084954-43085034)
chr8 (97-175)||(355837-355916)
chr8 (104-175)||(5220397-5220468)
chr8 (97-175)||(14053850-14053929)
chr8 (97-175)||(15207577-15207656)
chr8 (97-175)||(21559706-21559785)
chr8 (97-175)||(24573406-24573485)
chr8 (99-178)||(25630312-25630391)
chr8 (97-175)||(32989798-32989877)
chr8 (97-175)||(36893895-36893974)
chr8 (97-175)||(36894425-36894504)
chr8 (99-178)||(37747052-37747131)
chr8 (97-175)||(40520290-40520369)
chr8 (97-175)||(41257969-41258048)
chr8 (97-175)||(43284352-43284431)
chr8 (97-175)||(43923411-43923490)
chr8 (97-175)||(1650483-1650561)
chr8 (101-175)||(5219910-5219984)
chr8 (97-175)||(5794716-5794794)
chr8 (97-175)||(14053322-14053400)
chr8 (99-177)||(20832683-20832761)
chr8 (97-175)||(23916030-23916107)
chr8 (97-175)||(26430664-26430741)
chr8 (97-174)||(29100760-29100837)
chr8 (97-175)||(33880538-33880616)
chr8 (97-175)||(39407727-39407804)
chr8 (97-175)||(17960993-17961073)
chr8 (97-175)||(43433035-43433115)
chr8 (97-176)||(29101144-29101224)
chr8 (96-175)||(37429467-37429547)
chr8 (99-177)||(41450336-41450411)
chr8 (97-175)||(1650959-1651038)
chr8 (99-178)||(3416802-3416881)
chr8 (97-175)||(3454767-3454846)
chr8 (97-175)||(10825429-10825508)
chr8 (97-175)||(11856147-11856226)
chr8 (97-175)||(14450102-14450181)
chr8 (97-175)||(15211427-15211506)
chr8 (97-175)||(17960463-17960542)
chr8 (97-175)||(21558895-21558974)
chr8 (97-175)||(31127558-31127637)
chr8 (97-175)||(33871874-33871953)
chr8 (97-175)||(39407197-39407276)
chr8 (97-175)||(2657478-2657556)
chr8 (97-174)||(20166590-20166668)
chr8 (97-178)||(38713498-38713579)
chr8 (99-177)||(26796-26876)
chr8 (99-175)||(3927636-3927713)
chr8 (97-175)||(14244930-14245010)
chr8 (97-175)||(35942669-35942749)
chr8 (99-175)||(36468990-36469067)
chr8 (97-175)||(39324594-39324674)
chr8 (97-175)||(355308-355388)
chr8 (97-178)||(11650882-11650965)
chr8 (97-175)||(13002049-13002129)
chr8 (99-174)||(17925135-17925211)
chr8 (97-178)||(27072503-27072586)
chr8 (99-174)||(36255561-36255637)
chr8 (97-175)||(39133168-39133248)
chr8 (99-174)||(40450464-40450540)
chr8 (97-175)||(2656948-2657027)
chr8 (99-174)||(5690540-5690615)
chr8 (97-175)||(5795245-5795324)
chr8 (99-177)||(25094265-25094344)
chr8 (97-175)||(33872967-33873045)
chr8 (97-175)||(41257439-41257518)
chr8 (99-174)||(44308242-44308317)
chr8 (97-178)||(17924634-17924716)
chr8 (99-178)||(23564014-23564095)
chr8 (98-160)||(33872692-33872754)
chr8 (97-178)||(38713882-38713965)
chr8 (99-178)||(38714692-38714773)
chr8 (113-178)||(3177933-3177998)
chr8 (97-175)||(10308488-10308567)
chr8 (97-175)||(11651342-11651426)
chr8 (113-178)||(12764236-12764301)
chr8 (97-175)||(26431462-26431542)
chr8 (97-175)||(31917939-31918019)
chr8 (99-178)||(6653812-6653892)
chr8 (99-178)||(6734212-6734292)
chr8 (98-173)||(9114801-9114877)
chr8 (98-171)||(9736243-9736318)
chr8 (97-172)||(10307836-10307912)
chr8 (97-154)||(11178854-11178913)
chr8 (99-174)||(7482697-7482772)
chr8 (97-175)||(13001522-13001600)
chr8 (99-154)||(15730634-15730689)
chr8 (99-154)||(17733827-17733882)
chr8 (97-175)||(32989269-32989348)
chr8 (97-175)||(39132868-39132947)
chr8 (97-175)||(39325096-39325168)
chr8 (97-174)||(44445449-44445528)
chr8 (99-174)||(9879142-9879219)
chr8 (99-174)||(15601954-15602030)
chr8 (97-175)||(31918467-31918544)
chr8 (99-176)||(37428668-37428745)
chr8 (101-154)||(39864116-39864170)
chr8 (97-175)||(12383208-12383288)
chr8 (97-178)||(27071711-27071792)
chr8 (97-159)||(28776681-28776745)
chr8 (102-174)||(41450066-41450139)
chr8 (97-175)||(43085624-43085704)
chr8 (97-168)||(3926005-3926077)
chr8 (97-152)||(10831237-10831293)
chr8 (99-174)||(20166085-20166163)
chr8 (99-171)||(23564795-23564867)
chr8 (97-175)||(28776135-28776211)
chr8 (97-175)||(1077849-1077927)
chr8 (99-178)||(5691387-5691466)
chr8 (97-175)||(36507885-36507963)
chr8 (99-179)||(36573546-36573628)
chr8 (97-151)||(11179896-11179950)
chr8 (120-178)||(31204030-31204087)
chr8 (120-178)||(33852854-33852911)
chr8 (120-178)||(41392689-41392747)
chr8 (120-178)||(42994431-42994489)
chr8 (99-174)||(44444944-44445021)
chr8 (120-178)||(44671909-44671967)
chr8 (122-175)||(35942164-35942217)
chr8 (99-174)||(25953-26029)
chr8 (99-178)||(3418926-3419007)
chr8 (99-178)||(12503058-12503138)
chr8 (99-174)||(15565500-15565576)
chr8 (99-178)||(25631140-25631220)
chr8 (99-154)||(31819852-31819908)
chr8 (99-150)||(37746433-37746485)
chr8 (97-174)||(40449961-40450040)
chr8 (120-176)||(41543150-41543206)
chr8 (99-174)||(32449087-32449161)
chr8 (99-174)||(39863484-39863558)
chr8 (97-162)||(43284858-43284922)
chr8 (124-178)||(30729007-30729061)
chr8 (132-178)||(41575089-41575135)
chr8 (120-178)||(41576630-41576688)
chr8 (120-178)||(44869022-44869079)
chr8 (99-152)||(15564658-15564711)
chr8 (97-154)||(36740027-36740084)
chr8 (113-178)||(42356131-42356196)
chr8 (120-176)||(4488740-4488796)
chr8 (99-174)||(17732984-17733060)
chr8 (120-178)||(1143892-1143951)
chr8 (99-178)||(12502229-12502304)
chr8 (120-171)||(12764982-12765033)
chr8 (123-178)||(31204521-31204576)
chr8 (123-178)||(34055965-34056020)
chr8 (108-178)||(44629075-44629146)
chr8 (120-178)||(3178427-3178485)
chr8 (120-178)||(4484689-4484747)
chr8 (120-178)||(30728243-30728301)
chr8 (97-150)||(35772422-35772476)
chr8 (99-174)||(36251952-36252029)
chr8 (120-178)||(37262397-37262455)
chr8 (120-178)||(39584482-39584540)
chr8 (120-178)||(41393454-41393512)
chr8 (120-178)||(44671145-44671203)
chr8 (102-150)||(27575927-27575976)
chr8 (97-174)||(29732645-29732721)
chr8 (107-174)||(31820464-31820532)
chr8 (99-150)||(6869112-6869162)
chr8 (121-164)||(33851613-33851656)
chr8 (120-171)||(44868533-44868584)
chr8 (128-178)||(9263837-9263887)
chr8 (124-170)||(25617011-25617057)
chr8 (120-154)||(38256560-38256594)
chr8 (120-170)||(39583769-39583819)
chr8 (121-174)||(15633266-15633319)
chr8 (120-165)||(37261909-37261954)
chr8 (120-177)||(38257037-38257094)
chr8 (99-150)||(6869990-6870042)
chr8 (128-172)||(32449371-32449415)
[»] chr1 (239 HSPs)
chr1 (99-178)||(26537663-26537742)
chr1 (97-175)||(17273050-17273128)
chr1 (97-175)||(31196689-31196767)
chr1 (97-175)||(31434764-31434842)
chr1 (97-175)||(32832316-32832394)
chr1 (97-175)||(37587664-37587742)
chr1 (97-175)||(47433653-47433730)
chr1 (97-175)||(3898324-3898403)
chr1 (96-175)||(11992651-11992730)
chr1 (97-175)||(16265461-16265540)
chr1 (97-175)||(30751262-30751341)
chr1 (97-175)||(30753073-30753152)
chr1 (97-175)||(51619543-51619622)
chr1 (97-175)||(17273582-17273660)
chr1 (97-175)||(22775573-22775651)
chr1 (97-175)||(31676307-31676385)
chr1 (97-175)||(36304144-36304222)
chr1 (97-175)||(42246820-42246898)
chr1 (97-174)||(48803498-48803576)
chr1 (97-175)||(51000913-51000991)
chr1 (97-175)||(18053824-18053904)
chr1 (99-178)||(16797272-16797351)
chr1 (99-174)||(35156051-35156127)
chr1 (97-175)||(7436679-7436758)
chr1 (97-175)||(7437207-7437286)
chr1 (97-175)||(10386971-10387050)
chr1 (97-175)||(11992121-11992200)
chr1 (97-175)||(13242329-13242408)
chr1 (97-175)||(24982779-24982858)
chr1 (97-175)||(25227539-25227618)
chr1 (97-175)||(26442033-26442112)
chr1 (97-175)||(32074584-32074663)
chr1 (97-175)||(35894200-35894279)
chr1 (97-175)||(35894730-35894809)
chr1 (97-175)||(37538388-37538467)
chr1 (97-175)||(37613495-37613574)
chr1 (97-175)||(46804426-46804505)
chr1 (99-174)||(52869795-52869870)
chr1 (97-175)||(4512737-4512814)
chr1 (97-178)||(14403971-14404049)
chr1 (97-175)||(29674430-29674508)
chr1 (97-174)||(37612966-37613044)
chr1 (97-174)||(48803819-48803897)
chr1 (97-175)||(52359426-52359503)
chr1 (97-175)||(4469589-4469669)
chr1 (97-174)||(6783766-6783843)
chr1 (97-175)||(8384018-8384098)
chr1 (97-175)||(9061093-9061173)
chr1 (97-178)||(29329425-29329506)
chr1 (97-175)||(29358276-29358356)
chr1 (97-175)||(37276249-37276329)
chr1 (97-175)||(38788469-38788549)
chr1 (97-175)||(43680499-43680576)
chr1 (99-174)||(1799678-1799753)
chr1 (97-175)||(4632306-4632385)
chr1 (97-175)||(10387501-10387580)
chr1 (97-175)||(20898649-20898728)
chr1 (97-175)||(25228070-25228149)
chr1 (97-175)||(25859500-25859579)
chr1 (99-174)||(26615067-26615142)
chr1 (99-175)||(29329953-29330031)
chr1 (97-175)||(37275719-37275798)
chr1 (97-175)||(38456708-38456787)
chr1 (99-178)||(40315467-40315546)
chr1 (97-175)||(41115703-41115782)
chr1 (96-175)||(42246300-42246378)
chr1 (99-177)||(46294574-46294653)
chr1 (97-175)||(46803897-46803976)
chr1 (97-175)||(47434181-47434260)
chr1 (97-175)||(51000102-51000178)
chr1 (97-175)||(13265261-13265338)
chr1 (97-174)||(18611787-18611865)
chr1 (97-174)||(24250543-24250621)
chr1 (99-178)||(43214607-43214688)
chr1 (96-175)||(4514033-4514114)
chr1 (97-175)||(31196159-31196239)
chr1 (97-175)||(31675518-31675598)
chr1 (97-175)||(38457238-38457318)
chr1 (97-175)||(38787667-38787747)
chr1 (97-175)||(45508024-45508103)
chr1 (97-175)||(49204125-49204205)
chr1 (99-174)||(6783263-6783339)
chr1 (99-178)||(32814963-32815043)
chr1 (99-178)||(43760167-43760247)
chr1 (99-178)||(45141605-45141685)
chr1 (97-175)||(1024094-1024173)
chr1 (97-175)||(4470120-4470199)
chr1 (97-175)||(13242876-13242955)
chr1 (99-154)||(13533999-13534054)
chr1 (97-175)||(20899179-20899257)
chr1 (99-178)||(25376867-25376946)
chr1 (97-161)||(29357491-29357557)
chr1 (96-175)||(30634429-30634507)
chr1 (97-175)||(31435400-31435479)
chr1 (97-175)||(32831784-32831862)
chr1 (97-175)||(37587133-37587212)
chr1 (97-175)||(38834170-38834248)
chr1 (97-175)||(42148507-42148585)
chr1 (99-178)||(44431319-44431398)
chr1 (99-177)||(1798900-1798978)
chr1 (99-172)||(8897054-8897128)
chr1 (97-174)||(12770200-12770278)
chr1 (97-175)||(22776063-22776140)
chr1 (98-173)||(27234368-27234445)
chr1 (97-175)||(29674958-29675039)
chr1 (98-173)||(36304950-36305027)
chr1 (99-177)||(44432160-44432238)
chr1 (99-174)||(48720904-48720981)
chr1 (97-174)||(52870043-52870120)
chr1 (97-175)||(13149627-13149707)
chr1 (97-175)||(16266560-16266639)
chr1 (97-175)||(18054355-18054435)
chr1 (99-172)||(18611286-18611359)
chr1 (99-164)||(27234556-27234621)
chr1 (97-175)||(52360210-52360290)
chr1 (99-178)||(16798132-16798212)
chr1 (99-174)||(23703721-23703797)
chr1 (98-173)||(30753878-30753953)
chr1 (97-175)||(37812488-37812568)
chr1 (97-175)||(4212921-4212999)
chr1 (97-175)||(8383486-8383567)
chr1 (97-175)||(37813020-37813098)
chr1 (97-175)||(38617840-38617919)
chr1 (99-174)||(42233528-42233603)
chr1 (97-175)||(44396599-44396677)
chr1 (97-174)||(48721400-48721479)
chr1 (97-175)||(6917277-6917355)
chr1 (120-178)||(9033724-9033782)
chr1 (99-153)||(11202118-11202172)
chr1 (120-178)||(11707383-11707441)
chr1 (100-175)||(20358061-20358138)
chr1 (100-175)||(20561817-20561894)
chr1 (97-178)||(28296684-28296766)
chr1 (120-178)||(36723926-36723984)
chr1 (120-178)||(38623722-38623780)
chr1 (107-174)||(40116841-40116910)
chr1 (97-170)||(44397404-44397478)
chr1 (96-175)||(45508550-45508632)
chr1 (98-175)||(49203330-49203408)
chr1 (97-178)||(11184543-11184623)
chr1 (99-175)||(16834500-16834577)
chr1 (97-175)||(38833638-38833718)
chr1 (113-178)||(45217673-45217737)
chr1 (105-174)||(50642941-50643009)
chr1 (99-174)||(8897557-8897633)
chr1 (97-178)||(13698210-13698293)
chr1 (99-174)||(21247423-21247499)
chr1 (99-174)||(28297195-28297271)
chr1 (99-178)||(31050098-31050178)
chr1 (99-178)||(32186200-32186280)
chr1 (99-174)||(39364972-39365048)
chr1 (97-175)||(4631779-4631858)
chr1 (97-175)||(9055744-9055823)
chr1 (97-175)||(13158715-13158793)
chr1 (97-175)||(21040846-21040925)
chr1 (102-174)||(26615691-26615765)
chr1 (99-174)||(34556954-34557029)
chr1 (97-175)||(42149036-42149114)
chr1 (119-178)||(46585491-46585550)
chr1 (99-150)||(48751679-48751730)
chr1 (120-174)||(8742523-8742577)
chr1 (124-178)||(9034493-9034547)
chr1 (120-178)||(9680907-9680965)
chr1 (97-175)||(13697722-13697798)
chr1 (99-173)||(29487420-29487493)
chr1 (120-174)||(35392638-35392692)
chr1 (120-178)||(37327649-37327707)
chr1 (120-174)||(43505901-43505955)
chr1 (113-178)||(32536319-32536384)
chr1 (121-174)||(35155242-35155294)
chr1 (99-174)||(7287677-7287753)
chr1 (99-174)||(27235053-27235129)
chr1 (99-174)||(43281948-43282024)
chr1 (99-151)||(52870569-52870621)
chr1 (97-175)||(1023573-1023651)
chr1 (99-154)||(17826904-17826958)
chr1 (99-174)||(26189896-26189970)
chr1 (104-175)||(42128570-42128640)
chr1 (99-174)||(43215223-43215298)
chr1 (99-178)||(45142379-45142456)
chr1 (97-163)||(51547188-51547255)
chr1 (120-178)||(8741884-8741942)
chr1 (120-174)||(10373695-10373749)
chr1 (99-178)||(22388471-22388552)
chr1 (120-178)||(27326426-27326484)
chr1 (120-178)||(27326914-27326972)
chr1 (99-178)||(29487860-29487941)
chr1 (120-178)||(36723442-36723500)
chr1 (120-178)||(46584915-46584973)
chr1 (120-178)||(49216867-49216925)
chr1 (114-171)||(15926727-15926783)
chr1 (99-178)||(31058563-31058641)
chr1 (113-178)||(32537093-32537158)
chr1 (113-174)||(44432684-44432745)
chr1 (102-174)||(7288179-7288250)
chr1 (99-166)||(18807552-18807620)
chr1 (124-176)||(21246612-21246664)
chr1 (99-174)||(22389082-22389158)
chr1 (122-174)||(27134429-27134481)
chr1 (99-174)||(32814355-32814430)
chr1 (122-178)||(44157069-44157125)
chr1 (99-174)||(46295401-46295477)
chr1 (120-175)||(10509650-10509704)
chr1 (123-174)||(33740836-33740887)
chr1 (99-134)||(38065576-38065611)
chr1 (97-175)||(42413234-42413312)
chr1 (102-154)||(43281312-43281366)
chr1 (99-177)||(51596926-51597006)
chr1 (97-175)||(6918704-6918782)
chr1 (120-178)||(9680418-9680476)
chr1 (124-178)||(11706883-11706937)
chr1 (97-175)||(14404434-14404511)
chr1 (99-174)||(18542162-18542238)
chr1 (120-178)||(24480350-24480408)
chr1 (120-174)||(24482098-24482152)
chr1 (120-154)||(44209983-44210017)
chr1 (120-174)||(48731507-48731561)
chr1 (120-174)||(52580520-52580574)
chr1 (102-151)||(17825962-17826011)
chr1 (113-178)||(43505391-43505456)
chr1 (99-174)||(34557779-34557854)
chr1 (122-178)||(45216911-45216967)
chr1 (120-155)||(10613749-10613784)
chr1 (135-178)||(23703195-23703238)
chr1 (99-142)||(43594198-43594241)
chr1 (120-175)||(44744505-44744560)
chr1 (120-178)||(24482864-24482922)
chr1 (124-178)||(35393058-35393112)
chr1 (120-178)||(37328373-37328431)
chr1 (120-174)||(43281364-43281417)
chr1 (120-154)||(44209261-44209295)
chr1 (128-178)||(50643514-50643563)
chr1 (113-178)||(7875579-7875644)
chr1 (120-177)||(19076275-19076332)
chr1 (120-177)||(19124165-19124222)
chr1 (113-178)||(52579792-52579857)
chr1 (122-178)||(38623239-38623295)
chr1 (120-164)||(44156588-44156632)
chr1 (105-152)||(51546550-51546598)
[»] chr6 (86 HSPs)
chr6 (97-175)||(11625265-11625343)
chr6 (97-175)||(23767641-23767719)
chr6 (97-175)||(18739199-18739278)
chr6 (97-175)||(13045749-13045827)
chr6 (98-175)||(1326606-1326683)
chr6 (97-175)||(748766-748845)
chr6 (97-175)||(1060263-1060341)
chr6 (97-175)||(2318353-2318432)
chr6 (97-175)||(8812180-8812259)
chr6 (97-175)||(8812732-8812811)
chr6 (97-175)||(13209212-13209291)
chr6 (97-175)||(13209741-13209820)
chr6 (97-175)||(20856847-20856926)
chr6 (97-175)||(29678854-29678933)
chr6 (97-175)||(2317825-2317902)
chr6 (97-175)||(5430324-5430401)
chr6 (97-174)||(8742963-8743041)
chr6 (97-175)||(8748843-8748921)
chr6 (97-175)||(17994190-17994268)
chr6 (97-170)||(24110933-24111006)
chr6 (97-175)||(15145910-15145990)
chr6 (97-178)||(20857372-20857455)
chr6 (99-178)||(23075218-23075298)
chr6 (97-175)||(5417593-5417672)
chr6 (97-175)||(23066772-23066851)
chr6 (97-175)||(26609832-26609911)
chr6 (97-175)||(26610320-26610399)
chr6 (97-175)||(1059734-1059814)
chr6 (97-175)||(1327125-1327204)
chr6 (97-175)||(22821267-22821347)
chr6 (99-177)||(28537658-28537738)
chr6 (97-169)||(32628553-32628626)
chr6 (100-175)||(15127152-15127228)
chr6 (97-175)||(23767090-23767172)
chr6 (97-175)||(1155274-1155352)
chr6 (97-175)||(15146441-15146520)
chr6 (97-175)||(15968636-15968715)
chr6 (97-175)||(25404211-25404290)
chr6 (102-175)||(11158671-11158745)
chr6 (98-173)||(22504359-22504436)
chr6 (97-170)||(25404749-25404822)
chr6 (97-175)||(749287-749367)
chr6 (97-175)||(1050764-1050844)
chr6 (97-175)||(29678323-29678403)
chr6 (99-174)||(34657940-34658016)
chr6 (97-175)||(8939938-8940017)
chr6 (101-175)||(11624739-11624814)
chr6 (97-178)||(25163618-25163705)
chr6 (120-178)||(16894570-16894628)
chr6 (97-175)||(22822069-22822149)
chr6 (99-178)||(10624593-10624673)
chr6 (97-154)||(14394807-14394866)
chr6 (97-148)||(22504892-22504944)
chr6 (99-170)||(32155209-32155281)
chr6 (99-178)||(6138250-6138329)
chr6 (99-177)||(11099065-11099144)
chr6 (99-174)||(11099869-11099944)
chr6 (120-175)||(24110431-24110486)
chr6 (97-175)||(5400731-5400814)
chr6 (120-178)||(15191945-15192003)
chr6 (120-178)||(15468548-15468606)
chr6 (97-175)||(1049976-1050056)
chr6 (113-178)||(11640972-11641037)
chr6 (113-178)||(16895058-16895123)
chr6 (113-178)||(1798662-1798729)
chr6 (97-143)||(15127620-15127667)
chr6 (119-178)||(29723995-29724054)
chr6 (127-174)||(34658443-34658490)
chr6 (99-178)||(1563873-1563954)
chr6 (99-178)||(23074434-23074515)
chr6 (99-175)||(18738453-18738527)
chr6 (99-152)||(32154608-32154661)
chr6 (99-178)||(11957110-11957190)
chr6 (120-174)||(26583082-26583136)
chr6 (99-150)||(28538193-28538246)
chr6 (120-166)||(29212912-29212958)
chr6 (137-178)||(8589824-8589865)
chr6 (129-174)||(32597110-32597155)
chr6 (99-162)||(14608188-14608252)
chr6 (99-178)||(1563032-1563110)
chr6 (120-171)||(32596473-32596524)
chr6 (124-174)||(8590580-8590630)
chr6 (120-178)||(15468059-15468117)
chr6 (137-175)||(17994719-17994757)
chr6 (113-178)||(29723224-29723290)
chr6 (107-140)||(23597171-23597204)
[»] chr5 (211 HSPs)
chr5 (97-175)||(4153088-4153165)
chr5 (97-175)||(6680625-6680703)
chr5 (97-175)||(25338790-25338868)
chr5 (97-175)||(29373881-29373959)
chr5 (97-175)||(38395516-38395594)
chr5 (97-175)||(7482368-7482447)
chr5 (97-175)||(16048514-16048593)
chr5 (100-175)||(16869135-16869210)
chr5 (97-175)||(22613492-22613571)
chr5 (97-175)||(1829535-1829613)
chr5 (97-175)||(11445194-11445272)
chr5 (97-171)||(12404236-12404310)
chr5 (97-175)||(32273023-32273101)
chr5 (97-175)||(40315002-40315080)
chr5 (97-174)||(8407516-8407593)
chr5 (97-178)||(36778325-36778406)
chr5 (98-175)||(41411931-41412008)
chr5 (97-178)||(6845076-6845159)
chr5 (97-175)||(459604-459683)
chr5 (97-175)||(2061247-2061326)
chr5 (97-175)||(3508185-3508264)
chr5 (97-175)||(3508715-3508794)
chr5 (97-175)||(4152558-4152637)
chr5 (97-175)||(4844325-4844404)
chr5 (97-175)||(6166542-6166621)
chr5 (99-178)||(6915322-6915401)
chr5 (97-175)||(8160070-8160149)
chr5 (97-175)||(8160597-8160676)
chr5 (97-175)||(12403694-12403773)
chr5 (97-175)||(12736940-12737019)
chr5 (97-175)||(12799234-12799313)
chr5 (97-175)||(12799763-12799842)
chr5 (97-175)||(13306991-13307070)
chr5 (97-175)||(26395523-26395602)
chr5 (97-175)||(38483584-38483663)
chr5 (97-175)||(39406193-39406272)
chr5 (97-175)||(40195884-40195963)
chr5 (97-175)||(42437889-42437968)
chr5 (97-175)||(4843796-4843874)
chr5 (97-175)||(16353036-16353114)
chr5 (97-175)||(38465234-38465312)
chr5 (97-175)||(41412459-41412537)
chr5 (98-175)||(1830064-1830141)
chr5 (97-175)||(9772365-9772445)
chr5 (97-175)||(11445723-11445803)
chr5 (97-175)||(25482509-25482589)
chr5 (99-175)||(29373354-29373430)
chr5 (97-175)||(40195362-40195442)
chr5 (98-175)||(40315531-40315608)
chr5 (99-178)||(11277394-11277474)
chr5 (100-175)||(12366625-12366701)
chr5 (97-175)||(970538-970616)
chr5 (97-175)||(2060716-2060795)
chr5 (97-175)||(4299587-4299665)
chr5 (97-175)||(4912454-4912533)
chr5 (99-178)||(5576482-5576561)
chr5 (97-175)||(7482888-7482967)
chr5 (97-175)||(9475314-9475392)
chr5 (97-175)||(9475840-9475919)
chr5 (97-175)||(12367151-12367230)
chr5 (97-175)||(12736410-12736489)
chr5 (97-175)||(13306467-13306546)
chr5 (97-175)||(16868588-16868667)
chr5 (97-175)||(17526191-17526270)
chr5 (97-175)||(18146334-18146412)
chr5 (97-175)||(25481979-25482058)
chr5 (99-174)||(27188626-27188700)
chr5 (97-175)||(32272494-32272573)
chr5 (97-175)||(36810944-36811023)
chr5 (97-175)||(38143931-38144010)
chr5 (97-175)||(39760703-39760782)
chr5 (97-175)||(39761234-39761313)
chr5 (99-174)||(41085233-41085308)
chr5 (97-172)||(460141-460218)
chr5 (99-174)||(1144278-1144355)
chr5 (97-175)||(6166017-6166093)
chr5 (99-178)||(6809372-6809453)
chr5 (97-175)||(8408050-8408127)
chr5 (97-175)||(36779092-36779170)
chr5 (97-178)||(36811456-36811538)
chr5 (97-175)||(4911923-4912003)
chr5 (97-175)||(17085936-17086016)
chr5 (97-175)||(19289783-19289863)
chr5 (97-175)||(21632319-21632399)
chr5 (97-175)||(21640566-21640646)
chr5 (97-175)||(26396053-26396132)
chr5 (97-175)||(38465730-38465810)
chr5 (97-174)||(1143777-1143856)
chr5 (98-175)||(4104060-4104138)
chr5 (99-178)||(5577266-5577346)
chr5 (98-175)||(6845607-6845686)
chr5 (99-174)||(38424853-38424929)
chr5 (97-174)||(41210130-41210209)
chr5 (97-175)||(17526721-17526800)
chr5 (97-175)||(19289253-19289332)
chr5 (97-175)||(38186562-38186641)
chr5 (97-175)||(38211716-38211795)
chr5 (99-178)||(38977695-38977774)
chr5 (99-174)||(41209630-41209704)
chr5 (97-175)||(4104857-4104935)
chr5 (99-174)||(7951375-7951451)
chr5 (98-175)||(9772895-9772973)
chr5 (97-174)||(15180585-15180662)
chr5 (97-175)||(18145807-18145884)
chr5 (99-169)||(19292364-19292434)
chr5 (97-154)||(25338258-25338316)
chr5 (97-175)||(6681155-6681234)
chr5 (98-175)||(25823631-25823708)
chr5 (97-175)||(38396039-38396119)
chr5 (97-175)||(42341261-42341341)
chr5 (99-174)||(3307193-3307269)
chr5 (99-174)||(17647420-17647496)
chr5 (102-174)||(20730997-20731069)
chr5 (99-175)||(27257156-27257231)
chr5 (99-177)||(5574936-5575015)
chr5 (99-178)||(14197884-14197963)
chr5 (101-175)||(15181115-15181190)
chr5 (97-175)||(24324477-24324555)
chr5 (97-175)||(24361101-24361179)
chr5 (97-175)||(24361630-24361709)
chr5 (99-178)||(27341902-27341984)
chr5 (97-175)||(42341790-42341868)
chr5 (99-178)||(11157082-11157163)
chr5 (120-178)||(29235610-29235668)
chr5 (99-174)||(38978317-38978394)
chr5 (97-175)||(42438455-42438532)
chr5 (99-175)||(6865265-6865342)
chr5 (99-164)||(11157917-11157982)
chr5 (122-175)||(43067665-43067718)
chr5 (99-154)||(5790431-5790487)
chr5 (99-174)||(8505903-8505979)
chr5 (99-174)||(26359754-26359830)
chr5 (99-170)||(27341299-27341371)
chr5 (99-178)||(6808467-6808545)
chr5 (99-174)||(6835269-6835344)
chr5 (100-174)||(13545310-13545387)
chr5 (97-175)||(24325005-24325084)
chr5 (99-177)||(26359273-26359352)
chr5 (124-178)||(746501-746555)
chr5 (120-178)||(2745391-2745449)
chr5 (99-174)||(5574098-5574175)
chr5 (97-171)||(6864466-6864539)
chr5 (120-178)||(26394789-26394847)
chr5 (120-174)||(27500818-27500872)
chr5 (97-174)||(32293754-32293831)
chr5 (120-178)||(38090484-38090542)
chr5 (124-178)||(40988779-40988832)
chr5 (113-178)||(4000006-4000071)
chr5 (97-146)||(16362799-16362848)
chr5 (120-169)||(36498622-36498671)
chr5 (99-176)||(2301297-2301376)
chr5 (98-169)||(7978570-7978642)
chr5 (99-174)||(14196004-14196080)
chr5 (99-174)||(17648262-17648338)
chr5 (99-151)||(21086174-21086226)
chr5 (120-176)||(25751863-25751919)
chr5 (99-178)||(6914262-6914340)
chr5 (96-174)||(9587642-9587721)
chr5 (97-175)||(17587901-17587983)
chr5 (99-174)||(19293128-19293203)
chr5 (97-175)||(21640045-21640124)
chr5 (99-178)||(26242912-26242990)
chr5 (99-154)||(36086183-36086238)
chr5 (120-178)||(729488-729546)
chr5 (120-174)||(10623387-10623441)
chr5 (120-174)||(13968707-13968761)
chr5 (99-174)||(21362400-21362476)
chr5 (97-178)||(25823078-25823160)
chr5 (120-178)||(29835513-29835571)
chr5 (97-154)||(32294569-32294629)
chr5 (120-178)||(36499111-36499169)
chr5 (120-178)||(38091296-38091354)
chr5 (120-178)||(40988060-40988118)
chr5 (107-168)||(41084741-41084802)
chr5 (120-169)||(4001020-4001069)
chr5 (113-178)||(10622889-10622954)
chr5 (129-178)||(25525104-25525153)
chr5 (99-174)||(7950922-7950999)
chr5 (101-152)||(21360655-21360707)
chr5 (107-178)||(26244000-26244071)
chr5 (99-174)||(34216990-34217066)
chr5 (120-178)||(5382287-5382345)
chr5 (120-178)||(13968068-13968126)
chr5 (120-178)||(25752833-25752891)
chr5 (113-178)||(27500317-27500383)
chr5 (120-174)||(29835975-29836029)
chr5 (120-178)||(33159743-33159801)
chr5 (99-148)||(36089761-36089811)
chr5 (99-151)||(21085879-21085932)
chr5 (99-144)||(27188064-27188109)
chr5 (123-178)||(730254-730310)
chr5 (99-174)||(25455684-25455760)
chr5 (99-154)||(26662182-26662238)
chr5 (99-154)||(26933777-26933833)
chr5 (120-164)||(30971363-30971407)
chr5 (126-178)||(38424264-38424316)
chr5 (97-151)||(17587368-17587423)
chr5 (120-167)||(25525872-25525919)
chr5 (123-170)||(33158973-33159019)
chr5 (120-178)||(39048353-39048412)
chr5 (120-178)||(747407-747465)
chr5 (124-178)||(2744923-2744977)
chr5 (120-174)||(11276707-11276761)
chr5 (99-178)||(34217194-34217275)
chr5 (101-178)||(12852981-12853058)
chr5 (113-154)||(16868171-16868212)
chr5 (129-174)||(39047466-39047511)
chr5 (99-174)||(13544693-13544768)
chr5 (99-154)||(21305917-21305973)
chr5 (99-154)||(21313755-21313811)
chr5 (105-174)||(25456639-25456712)
[»] scaffold0444 (2 HSPs)
scaffold0444 (97-175)||(7924-8003)
scaffold0444 (97-175)||(7111-7190)
[»] scaffold0007 (3 HSPs)
scaffold0007 (97-175)||(41810-41888)
scaffold0007 (97-175)||(35967-36046)
scaffold0007 (97-175)||(41280-41359)
[»] scaffold0083 (2 HSPs)
scaffold0083 (97-177)||(3359-3440)
scaffold0083 (105-175)||(4623-4694)
[»] scaffold0060 (5 HSPs)
scaffold0060 (97-175)||(7216-7295)
scaffold0060 (97-175)||(7745-7824)
scaffold0060 (102-174)||(46646-46718)
scaffold0060 (96-174)||(66719-66798)
scaffold0060 (99-174)||(67224-67300)
[»] scaffold0036 (2 HSPs)
scaffold0036 (97-175)||(12426-12505)
scaffold0036 (97-175)||(12956-13036)
[»] scaffold0001 (1 HSPs)
scaffold0001 (97-175)||(185733-185812)
[»] scaffold0572 (1 HSPs)
scaffold0572 (97-175)||(1609-1687)
[»] scaffold0498 (2 HSPs)
scaffold0498 (97-175)||(5318-5395)
scaffold0498 (97-175)||(11233-11311)
[»] scaffold0095 (1 HSPs)
scaffold0095 (97-175)||(52351-52428)
[»] scaffold0041 (2 HSPs)
scaffold0041 (97-175)||(8077-8156)
scaffold0041 (97-175)||(7548-7627)
[»] scaffold0945 (2 HSPs)
scaffold0945 (97-174)||(2102-2180)
scaffold0945 (99-175)||(1301-1377)
[»] scaffold1532 (1 HSPs)
scaffold1532 (97-178)||(748-828)
[»] scaffold0445 (2 HSPs)
scaffold0445 (102-178)||(13467-13543)
scaffold0445 (99-178)||(12970-13049)
[»] scaffold0340 (2 HSPs)
scaffold0340 (99-177)||(2270-2349)
scaffold0340 (99-174)||(1438-1515)
[»] scaffold0031 (3 HSPs)
scaffold0031 (97-174)||(94380-94457)
scaffold0031 (99-174)||(94883-94959)
scaffold0031 (97-175)||(104383-104460)
[»] scaffold0008 (1 HSPs)
scaffold0008 (96-175)||(239296-239376)
[»] scaffold0343 (2 HSPs)
scaffold0343 (97-175)||(10262-10340)
scaffold0343 (97-175)||(10790-10868)
[»] scaffold0320 (2 HSPs)
scaffold0320 (97-175)||(15669-15748)
scaffold0320 (108-153)||(16156-16202)
[»] scaffold0219 (1 HSPs)
scaffold0219 (99-178)||(22262-22341)
[»] scaffold0022 (2 HSPs)
scaffold0022 (97-175)||(120762-120841)
scaffold0022 (97-175)||(121292-121370)
[»] scaffold0004 (4 HSPs)
scaffold0004 (102-177)||(38094-38169)
scaffold0004 (120-178)||(131039-131097)
scaffold0004 (123-178)||(131529-131584)
scaffold0004 (105-149)||(37817-37862)
[»] scaffold0057 (1 HSPs)
scaffold0057 (97-175)||(77086-77165)
[»] scaffold0006 (2 HSPs)
scaffold0006 (97-175)||(43286-43366)
scaffold0006 (97-175)||(41460-41532)
[»] scaffold0132 (1 HSPs)
scaffold0132 (99-174)||(42354-42430)
[»] scaffold0287 (1 HSPs)
scaffold0287 (97-175)||(17406-17486)
[»] scaffold1063 (2 HSPs)
scaffold1063 (99-174)||(894-969)
scaffold1063 (99-151)||(389-442)
[»] scaffold0608 (1 HSPs)
scaffold0608 (97-150)||(1846-1900)
[»] scaffold0140 (2 HSPs)
scaffold0140 (102-175)||(4509-4583)
scaffold0140 (99-167)||(5127-5195)
[»] scaffold0672 (2 HSPs)
scaffold0672 (113-171)||(5428-5486)
scaffold0672 (120-170)||(6207-6257)
[»] scaffold0474 (2 HSPs)
scaffold0474 (120-178)||(12287-12345)
scaffold0474 (120-178)||(13048-13106)
[»] scaffold0044 (1 HSPs)
scaffold0044 (96-175)||(59543-59622)
[»] scaffold0214 (2 HSPs)
scaffold0214 (123-174)||(28598-28649)
scaffold0214 (120-175)||(16500-16555)
[»] scaffold0066 (1 HSPs)
scaffold0066 (120-179)||(13535-13593)
[»] scaffold0015 (2 HSPs)
scaffold0015 (120-178)||(42395-42454)
scaffold0015 (113-178)||(41625-41689)
[»] scaffold0096 (2 HSPs)
scaffold0096 (99-174)||(34947-35024)
scaffold0096 (120-151)||(10708-10739)
[»] scaffold0249 (1 HSPs)
scaffold0249 (99-174)||(24397-24473)
[»] scaffold0063 (1 HSPs)
scaffold0063 (99-178)||(34145-34223)


Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 245)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 97 - 583
Target Start/End: Original strand, 4940194 - 4940666
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttgggatgtttgggcatata 196  Q
    ||||||||| ||||||||||||  || |||||||||||| |||||||||||||||||  |||| || ||||||||||||||||||||||||||||| |||    
4940194 tgaacatgatgttttgcaaatacaccatgaagttttgcaattatgtgcaaaatgccctccaaatttaaaaatttatatttttgggatgtttgggca-ata 4940292  T
197 cacaggtgaggaagttggaactgctgatttcaatttcaattctagtatttgtaatggcggcatgtttctttggtgaattgagctatggaaaaccccctcc 296  Q
     |||||||||||||||||||||||| |||||||||      ||||||||||||||||| |||||||||||||||||||||||||||| |||||||| | |    
4940293 tacaggtgaggaagttggaactgcttatttcaatt------ctagtatttgtaatggctgcatgtttctttggtgaattgagctatgtaaaacccc-tgc 4940385  T
297 taaaggagtaattaagcgaatat-tgattaactgagtacatactaatattatatgacatatatttaattgattatgcaggatgcatgcagatgctttctc 395  Q
    |||||||||||||||| |||||| || |||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| || ||||||     
4940386 taaaggagtaattaagggaatatctggttaattgagtacatactaatattatatgacatatattcaattgattacgcaggatgcatgcaaatactttcta 4940485  T
396 attgagagtggtttcgcgctgttcgttgcatttctaatcaatgttgcaatgatttatgtgactggtactgtttgcaaagctgatgatacttctggagaga 495  Q
    ||||||||||||||||       |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||    
4940486 attgagagtggtttcg-------cgttgcatttctaatcaatgttgcaatgatttttgtgactggtactgtttacaaagctgatgatatttctgaagaga 4940578  T
496 atactgatcgttgcaatgatattacccttgactttgcttctttcattctcctagtttctaatttagttcaatttgcaactattatggt 583  Q
    || |||||||||||||||||||||| ||| ||| |||||||||| ||||||  ||| |||||||| |||| | | |||||||||||||    
4940579 atgctgatcgttgcaatgatattactcttaactctgcttctttccttctccaggttcctaatttacttcactctccaactattatggt 4940666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 320 - 583
Target Start/End: Original strand, 38350966 - 38351229
Alignment:
320 tgattaactgagtacatactaatattatatgacatatatttaattgattatgcaggatgcatgcagatgctttctcattgagagtggtttcgcgctgttc 419  Q
    ||||||| ||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||| || |||||||||||||||||||||| || |||||    
38350966 tgattaattgagtacatgctaatattatatgacatatatttaatagattatgcgggatgcatgcatatactttctcattgagagtggtttcacgttgttc 38351065  T
420 gttgcatttctaatcaatgttgcaatgatttatgtgactggtactgtttgcaaagctgatgatacttctggagagaatactgatcgttgcaatgatatta 519  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||||||||    
38351066 gttgcatttctaatcaatgttgcaatgatttatgtgactggtactgcttgcaaagctgatgatatttctggagagaatgctgatcgttgcaatgatatta 38351165  T
520 cccttgactttgcttctttcattctcctagtttctaatttagttcaatttgcaactattatggt 583  Q
    ||||| ||| |||||||||| ||||||  ||| ||||||||||||| |||||||||||||||||    
38351166 cccttaactctgcttctttccttctccaggttcctaatttagttcactttgcaactattatggt 38351229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 97 - 320
Target Start/End: Original strand, 21310950 - 21311166
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttgggatgtttgggcatata 196  Q
    |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||     
21310950 tgaacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttatatttttgggatgtttgggcatat- 21311048  T
197 cacaggtgaggaagttggaactgctgatttcaatttcaattctagtatttgtaatggcggcatgtttctttggtgaattgagctatggaaaaccccctcc 296  Q
     ||||||||||||||||||||| ||||||||||||     |  ||||||||||||||| ||||||||||||||||||||||||||||  ||| ||||| |    
21311049 -acaggtgaggaagttggaactcctgatttcaatt----ctagagtatttgtaatggctgcatgtttctttggtgaattgagctatgtgaaa-cccctgc 21311142  T
297 taaaggagtaattaagcgaatatt 320  Q
    |||||||||||||||| |||||||    
21311143 taaaggagtaattaagggaatatt 21311166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 320 - 460
Target Start/End: Original strand, 21311525 - 21311665
Alignment:
320 tgattaactgagtacatactaatattatatgacatatatttaattgattatgcaggatgcatgcagatgctttctcattgagagtggtttcgcgctgttc 419  Q
    ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||||||||| || |||||    
21311525 tgattaattgagtacatactaatattatatgacatatattgaattgattatgcaggacgcatgcagatactttctcattgagagtggtttcacgatgttc 21311624  T
420 gttgcatttctaatcaatgttgcaatgatttatgtgactgg 460  Q
    ||||||||||| ||||||||||||||||||| |||||||||    
21311625 gttgcatttctgatcaatgttgcaatgatttctgtgactgg 21311665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 97 - 232
Target Start/End: Original strand, 38350461 - 38350590
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttgggatgtttgggcatata 196  Q
    |||||||||||||||||||||| |||||    |||||||||||||||||||||| | | |||||||||||||||| |||||||||||||||||||||||     
38350461 tgaacatgacgttttgcaaataccccct----ttttgcacttatgtgcaaaatgtctcccaaacttgaaaatttaaatttttgggatgtttgggcatat- 38350555  T
197 cacaggtgaggaagttggaactgctgatttcaattt 232  Q
     ||||||||||||||||||||  |||||||||||||    
38350556 -acaggtgaggaagttggaaccactgatttcaattt 38350590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 487 - 583
Target Start/End: Original strand, 21311662 - 21311758
Alignment:
487 ctggagagaatactgatcgttgcaatgatattacccttgactttgcttctttcattctcctagtttctaatttagttcaatttgcaactattatggt 583  Q
    ||||||||||| |||||||||||||||||||||||||| ||| |||||||||| |||||| |||| ||||||||||||| |||||||||||||||||    
21311662 ctggagagaatgctgatcgttgcaatgatattacccttaactctgcttctttccttctccaagttcctaatttagttcagtttgcaactattatggt 21311758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 96 - 175
Target Start/End: Original strand, 32860058 - 32860137
Alignment:
96 atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
32860058 atgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 32860137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 96 - 175
Target Start/End: Original strand, 34476168 - 34476247
Alignment:
96 atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
34476168 atgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 34476247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6528322 - 6528400
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
6528322 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt 6528400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24318631 - 24318553
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
24318631 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt 24318553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 29246166 - 29246088
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
29246166 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 29246088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40131149 - 40131227
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
40131149 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt 40131227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6922801 - 6922722
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
6922801 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 6922722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41744855 - 41744777
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||  ||||||| ||||||||||||    
41744855 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt 41744777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 23466351 - 23466274
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||| |||||||||||    
23466351 tgaacatgacgttttgcaaataccccctgaagttttgcagttatgtgcaaaatgccccccaaacttaaaaatttatat 23466274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 98 - 178
Target Start/End: Complemental strand, 55497225 - 55497145
Alignment:
98 gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||    
55497225 gaacatgaagttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatgttttt 55497145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 917907 - 917986
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
917907 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 917986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1617974 - 1618053
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
1617974 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttcaaaatttatatt 1618053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6239083 - 6239004
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
6239083 tgaacatggcgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 6239004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6259787 - 6259708
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
6259787 tgaacatggcgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 6259708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 28255282 - 28255361
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
28255282 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 28255361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 30357221 - 30357142
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
30357221 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 30357142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32860618 - 32860539
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
32860618 tgaatatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 32860539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 36111614 - 36111689
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||   |||||||||||||||||    
36111614 aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatat 36111689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 37998136 - 37998215
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
37998136 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 37998215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37998745 - 37998666
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
37998745 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 37998666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41790160 - 41790081
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
41790160 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 41790081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 44255342 - 44255261
Alignment:
97 tgaacatgacgttttgcaaata---tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
44255342 tgaacatgacgttttgcaaataccctcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 44255261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 50181386 - 50181465
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
50181386 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 50181465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 55083460 - 55083381
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||    
55083460 aacataacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatttt 55083381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6194255 - 6194333
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
6194255 tgaacatgacattttgcaaataccccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 6194333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6194861 - 6194783
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||| ||||||| ||||||||||||    
6194861 tgaacatgacgttttgcaaatagcccctaaagtttttcacttatgtgcaaaatgccccacaaacttaaaaatttatatt 6194783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 22535937 - 22535855
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||||||    
22535937 tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatattttt 22535855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 22731799 - 22731721
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||    
22731799 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 22731721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 36112197 - 36112120
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||   ||||||||||||||||||||    
36112197 aacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatatttt 36112120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 47838084 - 47838162
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||| | | ||||||| ||||||||||||    
47838084 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtctcccaaacttaaaaatttatatt 47838162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 48614051 - 48613973
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||    
48614051 tgaacatgatgttttgcaaataccccctgtagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 48613973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 56279900 - 56279978
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||    
56279900 tgaacatgaagttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 56279978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6259177 - 6259257
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
6259177 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 6259257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 6644154 - 6644232
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||  |||||||||||||||||||||||    
6644154 aacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgccc--caaacttgaaaatttatattttt 6644232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 17607685 - 17607605
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
17607685 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 17607605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21659963 - 21659883
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
21659963 tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 21659883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 21861352 - 21861432
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
21861352 tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 21861432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21861964 - 21861884
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
21861964 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 21861884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 21917213 - 21917293
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
21917213 tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 21917293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21917825 - 21917745
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
21917825 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 21917745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 27179928 - 27180008
Alignment:
97 tgaacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
27179928 tgaacatgacgttttgcaaataccccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 27180008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 28255892 - 28255812
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
28255892 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 28255812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 30114024 - 30113944
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
30114024 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 30113944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 12594708 - 12594788
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||    
12594708 aacatgatgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttatattttt 12594788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 21857745 - 21857825
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| |||||||||||||||    
21857745 aacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatattttt 21857825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 21913608 - 21913688
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| |||||||||||||||    
21913608 aacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatattttt 21913688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 97 - 176
Target Start/End: Complemental strand, 23475873 - 23475793
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaat-gccccgcaaacttgaaaatttatattt 176  Q
    |||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||||| ||||||| |||||||||||||    
23475873 tgaacatgacgttttgcaaataccccctgaagttttgcacttatatgcaaaatcgccccccaaacttaaaaatttatattt 23475793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 171
Target Start/End: Original strand, 1195068 - 1195143
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||    
1195068 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaattta 1195143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 17215904 - 17215825
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||  ||| ||||||||| ||||||||    
17215904 aacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaatttgaaaattcatattttt 17215825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 18963440 - 18963519
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| ||||||| ||||||||||||    
18963440 tgaacatgacgttttgcaaatacccccctgaagttttgcagttatgtgcaaaatgccccccaaacttaaaaatttatatt 18963519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 20598828 - 20598907
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||| || ||||||| ||||||||||||    
20598828 tgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgcaccccaaacttaaaaatttatatt 20598907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 20599436 - 20599357
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
20599436 tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 20599357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 22524435 - 22524513
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||||| |||||||||| |||||||||||||||||| | |||||||||||||||||||||    
22524435 aacatgacgttttgcaaataccccctaaagttttgcaattatgtgcaaaatgcccc-cgaacttgaaaatttatattttt 22524513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30288790 - 30288869
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||  |||||| ||||||||||||    
30288790 tgaacatgacgttttacaaatatccccctgaagttttgcacttatgtgcaaaatgcccccgaaacttaaaaatttatatt 30288869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30317692 - 30317771
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||  |||||| ||||||||||||    
30317692 tgaacatgacgttttacaaatatccccctgaagttttgcacttatgtgcaaaatgcccccgaaacttaaaaatttatatt 30317771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32826183 - 32826104
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
32826183 tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 32826104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 33821220 - 33821299
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
33821220 tgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 33821299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 34825409 - 34825330
Alignment:
97 tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||| ||||||  ||||||||||||    
34825409 tgaacatgacgttttgcaaatacacccctgaagttttgcacttatgtgcaaaatgccccccaaactcaaaaatttatatt 34825330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 103 - 178
Target Start/End: Original strand, 38575681 - 38575755
Alignment:
103 tgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||    
38575681 tgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatg-ccctcgaacttgaaaatttatattttt 38575755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 40145781 - 40145856
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||| | |||||||||||||||||    
40145781 aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaaaatttatat 40145856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 45895500 - 45895578
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
45895500 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 45895578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 48613443 - 48613522
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| | ||||| ||||||||||||    
48613443 tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgcccccctaacttaaaaatttatatt 48613522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 50605187 - 50605108
Alignment:
96 atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||  ||| || ||||||||||||    
50605187 atgaacatgacgttttgcaaataccccctgaagttttgcacttatgtacaaaatgccccctaaatttaaaaatttatatt 50605108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 3886117 - 3886035
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||| || | ||||| |||||||||||||||    
3886117 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgctccccgaacttaaaaatttatattttt 3886035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13994474 - 13994396
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||| |||||||||| |||| ||||||| ||| ||||||||    
13994474 tgaacatgacgttttgcaaataccccctgaagttttgcacttgtgtgcaaaataccccccaaacttaaaattttatatt 13994396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23465743 - 23465821
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||| | ||||| ||||||||||||    
23465743 tgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccccgaacttaaaaatttatatt 23465821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 44254784 - 44254862
Alignment:
98 gaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||  ||||||| ||||||||||||    
44254784 gaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt 44254862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 9025099 - 9025022
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| | || |||||||||||||||| |||||||| |||| |||||||||||||||||||    
9025099 tgaacatgacgttttgcaaatacctccagaagttttgcacttatatgcaaaataccccccaaacttgaaaatttatat 9025022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 24792481 - 24792404
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| |||| ||||||    
24792481 tgaacgtgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaaattatat 24792404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 24815780 - 24815857
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| |||| ||||||    
24815780 tgaacgtgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaaattatat 24815857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 34476780 - 34476700
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
34476780 tgaacatgacgttttgcaaatacccccgctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 34476700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 34824807 - 34824886
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||||  |||||||||||||||||||| |||||||||| ||||||| ||||||||||||    
34824807 tgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgtgtaaaatgcccc-caaacttaaaaatttatatt 34824886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 50181996 - 50181916
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  |||||||||||||||||||||||||| |||| ||||||| ||||||||||||    
50181996 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaatttatatt 50181916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 51110756 - 51110679
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |||| || ||||||||||||    
51110756 aacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccctcaaatttaaaaatttatatt 51110679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 52346252 - 52346173
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
52346252 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaactt-aaaatttatatt 52346173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 1862093 - 1862010
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||| |||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||    
1862093 tgaacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatgttttt 1862010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 12595360 - 12595280
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| | ||||| |||||||||||||||    
12595360 aacatgacattttgcaaatagccccctgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatattttt 12595280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 12800347 - 12800423
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgc-aaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||    ||||||||||||||||||    
12800347 aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccgtttaaacttgaaaatttatat 12800423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 17215070 - 17215150
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||   |||||||||||||||||||||    
17215070 aacatgacgttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatattttt 17215150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 17971680 - 17971601
Alignment:
98 gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
17971680 gaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 17971601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 23475263 - 23475341
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| |||||||||||    
23475263 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatat 23475341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 23590612 - 23590692
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||| | |   |||||||||||||||||||||    
23590612 aacatgacgttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgtctcctgaacttgaaaatttatattttt 23590692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 26477066 - 26476986
Alignment:
96 atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| |||| |||||||||||||||||| |||||||| ||| ||||||| ||||||||||||    
26477066 atgaacatgacgttttgcaaatacccccctgaagttttgcacttatgcgcaaaatgtcccccaaacttaaaaatttatatt 26476986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30356616 - 30356691
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||   || ||||||| ||||||||||||    
30356616 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaat---ccccaaacttaaaaatttatatt 30356691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 31559866 - 31559787
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| | ||||| |||||||||||||||    
31559866 aacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatacccc-cgaacttaaaaatttatattttt 31559787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 34733262 - 34733186
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| | |||||||||||||||||    
34733262 aacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat 34733186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1195677 - 1195598
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| |||||||||||||||| | ||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
1195677 tgaacatgacattttgcaaatatccccataaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 1195598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 22535329 - 22535408
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||  ||||||| ||||||||||||    
22535329 tgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt 22535408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 22731191 - 22731270
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
22731191 tgaacataacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 22731270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24317756 - 24317834
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| ||||||| ||||||||||||    
24317756 tgaacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 24317834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25644786 - 25644865
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| |||| |||||| ||||||||||||||||||| ||||| | ||||||||||||    
25644786 tgaacatgacgttttgcaaatatccccctgaaattttgcgcttatgtgcaaaatgccccccaaacctaaaaatttatatt 25644865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 27716266 - 27716188
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||| | ||||||||||||||||||    
27716266 tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgaccc-cgaacttgaaaatttatatt 27716188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 29245560 - 29245638
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||  |||||| ||||||||||||    
29245560 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-aaaacttaaaaatttatatt 29245638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38901485 - 38901564
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||   ||||||| ||||||||||||    
38901485 tgaacatgatgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccttccaaacttaaaaatttatatt 38901564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41789323 - 41789401
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
41789323 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgaccc-caaacttaaaaatttatatt 41789401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 51110182 - 51110260
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| | ||||||| ||||||||||||    
51110182 tgaacatgacgttttgcaaatatccccctgaagttttgcatttatgtgcaaaatgcctc-caaacttaaaaatttatatt 51110260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 56280479 - 56280404
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||| ||||||||||||| |||||||||||||||||| || | |||||||||||||||||    
56280479 aacataacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgctccccgaacttgaaaatttatat 56280404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 107 - 178
Target Start/End: Complemental strand, 56473724 - 56473653
Alignment:
107 gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||| ||||||||||||||||||||||| ||||||||||| | |||||||||||||||| ||||    
56473724 gttttgcaaataccccctgaagttttgcacttatgtacaaaatgccccccgaacttgaaaatttataatttt 56473653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 1614893 - 1614816
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||   |||||||||||||||||    
1614893 aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatat 1614816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 170
Target Start/End: Complemental strand, 18964050 - 18963976
Alignment:
97 tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    |||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||  |||||| |||||||    
18964050 tgaacatgacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaattt 18963976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 34732682 - 34732760
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || |||||||||||    
34732682 tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaagttaaaaatttatat 34732760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38902092 - 38902014
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| |||||||||||||||||||||||||| |||||||||||||||  ||||| ||| ||||||| ||||||||||||    
38902092 tgaatatgacgttttgcaaatatcccctgaaattttgcacttatgtggcaaatgtcccccaaacttaaaaatttatatt 38902014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13966831 - 13966911
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||||  |||||||||||| |||||||||||||||||| ||||| | | ||||||||||    
13966831 tgaacatgacgttttgcaaatatcccccctgaagttttgcatttatgtgcaaaatgccccccaaacataataatttatatt 13966911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13993861 - 13993945
Alignment:
97 tgaacatgacgttttgcaaatatcccc------tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||      ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
13993861 tgaacatgacgttttgcaaataccccccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 13993945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 26763312 - 26763232
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| ||  |||||||||||||||||||||||||| || | | |||||||||||||||||||||    
26763312 tgaacatgacgttttgcaaatacccattgaagttttgcacttatgtgcaaaataccac-cgaacttgaaaatttatattttt 26763232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 27180539 - 27180459
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||| ||  ||||||| ||||||||||||    
27180539 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcctccaaacttcaaaatttatatt 27180459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 101 - 178
Target Start/End: Original strand, 29342580 - 29342657
Alignment:
101 catgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||| ||||||||||||||||||||| || |||||| | | ||||||| |||||||||||||||    
29342580 catgacgttttgcaaataccccctgaagttttgcacttatatgtaaaatgtctcccaaacttaaaaatttatattttt 29342657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 29761503 - 29761582
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
29761503 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtccc-caaacttaaaaatttatatt 29761582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 173
Target Start/End: Complemental strand, 47838822 - 47838746
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata 173  Q
    |||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| ||||||| ||||||||||    
47838822 tgaacatgacgttttgcaaatacccctctgaagtttttcacttatgtgcaaaatgcccc-caaacttaaaaatttata 47838746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 6076921 - 6076997
Alignment:
99 aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| ||||||||||||| ||||||||||||||| ||||||||||||||| |||  ||||||||||||||||||    
6076921 aacatgatgttttgcaaatattcccctgaagttttgcgcttatgtgcaaaatgacccataaacttgaaaatttatat 6076997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 7390071 - 7389995
Alignment:
99 aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| ||||||||||||| ||||||||||||||| ||||||||||||||| |||  ||||||||||||||||||    
7390071 aacatgatgttttgcaaatattcccctgaagttttgcgcttatgtgcaaaatgacccataaacttgaaaatttatat 7389995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 152
Target Start/End: Complemental strand, 7972896 - 7972840
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgcc 152  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
7972896 tgaacatgacgttttgcaaatatccctctgaagttttgcacttatgtgcaaaatgcc 7972840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 23161231 - 23161311
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||   ||||||||| ||| |||||||    
23161231 aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaattttttattttt 23161311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 39333513 - 39333593
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||| |||||||||||| |||||||||||| |||||  ||||||||||||| || |||||    
39333513 aacatgacgttttgcaaatatccccctgaagttttgcagttatgtgcaaaacgccccctaaacttgaaaattcattttttt 39333593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 47309170 - 47309094
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| || ||||||||||| ||||||||||||||||||||| | |||||||||||||||||    
47309170 aacatgatgttttgcaaatactctcctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat 47309094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 48800380 - 48800301
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| ||||||||||||   |||||||||||||||||||||||||||||||| || ||||||| |||||||||||    
48800380 tgaacatgaagttttgcaaatacaccccctgaagttttgcacttatgtgcaaaatgctccccaaacttaaaaatttatat 48800301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 56443264 - 56443337
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| ||||| |||||||| |||||||||||||||||||||  |||||||||||||||||    
56443264 aacatgatgttttgcaaataccccctcaagttttgtacttatgtgcaaaatgccccg--aacttgaaaatttatat 56443337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 918515 - 918437
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||| ||||||| |||| |||||||||||||||||||||||||||| || ||||||| ||||||||||||    
918515 tgaacatgacgtttcgcaaatacccccctgaagttttgcacttatgtgcaaaatgctcc-caaacttaaaaatttatatt 918437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 6644883 - 6644804
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||  ||||||||||||||||||||||||||||||| |  | ||||| ||||||||| |||||    
6644883 aacatgacgttttgcaaatactccctgaagttttgcacttatgtgcaaaatgctctccgaacttaaaaatttatgttttt 6644804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13967714 - 13967635
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| || || ||||||||||||||| ||||||||| ||| ||||||| ||||||||||||    
13967714 tgaacatgacgttttgcaaatattcctctaaagttttgcacttatatgcaaaatgtcccccaaacttaaaaatttatatt 13967635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 23161940 - 23161866
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||| | ||||| |||||||||||    
23161940 aacataacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgcccc-cgaactttaaaatttatat 23161866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26476460 - 26476538
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||| |||||||||| | ||||| ||||||||||||    
26476460 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgtaaaatgcccc-ccaacttaaaaatttatatt 26476538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 29617539 - 29617464
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||| |||||| ||| |||| ||||||||||||||||||||| ||||  ||||||||||||||||||    
29617539 aacatgacgtttttcaaataccccatgaaattttgcacttatgtgcaaaataccccttaaacttgaaaatttatat 29617464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 101 - 175
Target Start/End: Complemental strand, 29762377 - 29762302
Alignment:
101 catgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||| |||| ||||||||||||||||||||||| |||||||  |||||| ||||||||||||    
29762377 catgacgttttgcaaatacccccctgaagttttgcacttatgtgcaagatgccccctaaacttaaaaatttatatt 29762302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 31559167 - 31559218
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg 150  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||    
31559167 aacatgacgttttgcaaatatcccctgaagttttgcacttatgttcaaaatg 31559218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 37687740 - 37687663
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| |||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
37687740 aacataacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaactttaaaatttatatt 37687663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 40132478 - 40132423
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
40132478 cccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 40132423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 41611431 - 41611356
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||| |||||||||||||||||||||||||||||   | ||||| |||||||||||    
41611431 aacatgacgttttgcaaataccccttgaagttttgcacttatgtgcaaaatgccatccgaacttaaaaatttatat 41611356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42592043 - 42592122
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| ||||||||||||||| | ||| |||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
42592043 tgaaaatgacgttttgcaaaaaccccgctgaagttttgcacttatgtgcaaaatgacccccaaacttaaaaatttatatt 42592122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #136
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42593537 - 42593458
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| | || |||||||||||||||||||||||||| ||||||| ||| ||||||||    
42593537 tgaacatgacgttttgcaaataccccccttaaattttgcacttatgtgcaaaatgccccccaaacttaaaagtttatatt 42593458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #137
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 50604578 - 50604657
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||| ||||| || || ||||||| ||||||||||||    
50604578 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtacaaaacgctccccaaacttaaaaatttatatt 50604657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #138
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 55496646 - 55496724
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| |||||| ||||| ||||||||||||| |||||||||||||||||| || | |||||||||||||||||||||    
55496646 aacatgatgttttgtaaata-cccctgaagttttacacttatgtgcaaaatgctcctcgaacttgaaaatttatattttt 55496724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #139
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 56444178 - 56444100
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| |||| ||||||||||||||||||||||||||||| |  |||||||||||||||||||||    
56444178 aacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctc-taaacttgaaaatttatatttt 56444100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #140
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 17971110 - 17971168
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||    
17971110 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc 17971168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #141
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24791624 - 24791702
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  || ||||||||||| |||||||||||||| |||| || ||||||||||||    
24791624 tgaacatgacgttttgcaaatacccccctaaattttgcacttacgtgcaaaatgcccctcaaatttaaaaatttatatt 24791702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #142
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24816637 - 24816559
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  || ||||||||||| |||||||||||||| |||| || ||||||||||||    
24816637 tgaacatgacgttttgcaaatacccccctaaattttgcacttacgtgcaaaatgcccctcaaatttaaaaatttatatt 24816559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #143
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 32464951 - 32465008
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||    
32464951 cccctgaagttttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttatattttt 32465008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #144
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 42259415 - 42259493
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||||||||||| |||||| |||| ||| ||||||||| ||||||||||||||||   ||||||||||||||||||||    
42259415 aacatgacgttttacaaataccccccgaaattttgcactcatgtgcaaaatgccccatgaacttgaaaatttatatttt 42259493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #145
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 165
Target Start/End: Original strand, 45764641 - 45764707
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaa 165  Q
    |||||||||||||||| ||| |||||||||||||||| |||||||||| ||||||| ||||||||||    
45764641 aacatgacgttttgcagataccccctgaagttttgcagttatgtgcaacatgccccccaaacttgaa 45764707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #146
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 45765625 - 45765568
Alignment:
99 aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||    
45765625 aacatgacgttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgcccc 45765568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #147
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 47308614 - 47308668
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
47308614 cccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 47308668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #148
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 105 - 174
Target Start/End: Original strand, 6507615 - 6507683
Alignment:
105 acgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||| ||||||||||||||||||||||||||||| ||||| | ||||| |||||||||||    
6507615 acgttttgcaaataccccctgaagttttgcacttatgtgcaaaaagcccc-cgaacttaaaaatttatat 6507683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #149
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 19170284 - 19170219
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||||||||||||||  ||||||||||||||| ||||||    
19170284 caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttagattttt 19170219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #150
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 102 - 178
Target Start/End: Original strand, 25705401 - 25705478
Alignment:
102 atgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||| |||| ||||||||||||||||||||||||| | | | | |||||||||||||||||||||    
25705401 atgacgttttgcaaatacccccgtgaagttttgcacttatgtgcaaaaagtctcccgaacttgaaaatttatattttt 25705478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #151
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 159
Target Start/End: Original strand, 26171811 - 26171875
Alignment:
97 tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaa 159  Q
    ||||||||| ||||||||||||  |||||||||||||||||||||||||||||||||||| ||||    
26171811 tgaacatgaagttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgccccccaaa 26171875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #152
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 113 - 174
Target Start/End: Complemental strand, 42987999 - 42987938
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||| || ||||| ||||||||||||||||||||||||||| ||||||||||||||||||    
42987999 caaataccctctgaaattttgcacttatgtgcaaaatgccccgtaaacttgaaaatttatat 42987938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #153
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 52177344 - 52177265
Alignment:
99 aacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||| ||||||||||||| ||||   |||||||||||||||||||||||||||||||   ||||||||||||||||||    
52177344 aacatggcgttttgcaaataaccccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaaatttatatt 52177265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #154
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 21858443 - 21858367
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| ||||| ||| |||||||||||| |||||||||| || |||||||||||||||||||    
21858443 aacatgatgttttgcaaatacccccttgaaattttgcacttatatgcaaaatgcaccccaaacttgaaaatttatat 21858367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #155
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 21914306 - 21914230
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| ||||| ||| |||||||||||| |||||||||| || |||||||||||||||||||    
21914306 aacatgatgttttgcaaatacccccttgaaattttgcacttatatgcaaaatgcaccccaaacttgaaaatttatat 21914230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #156
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 101 - 174
Target Start/End: Complemental strand, 29861029 - 29860954
Alignment:
101 catgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||| ||  ||||||||||| ||||||||||||||||||| | | |||||||||||||||||    
29861029 catgacgttttgcaaataccctccctgaagttttacacttatgtgcaaaatgcctcccgaacttgaaaatttatat 29860954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #157
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 35194842 - 35194790
Alignment:
102 atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||||||||||||||| ||| |||||||||||||||||||||||||||||||    
35194842 atgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgcccc 35194790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #158
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 48083079 - 48083159
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||| ||||||||| |||| |||||||||||||||||||||||||||||||   || || |||||||||||||||    
48083079 aacatgacgtcttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctgaatttaaaaatttatattttt 48083159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #159
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 172
Target Start/End: Complemental strand, 1618580 - 1618506
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    |||||||||||||||||||||| ||||||||||||||| |||| |||||||||  ||| ||||||| |||||||||    
1618580 tgaacatgacgttttgcaaata-cccctgaagttttgcgcttacgtgcaaaatatcccccaaacttaaaaatttat 1618506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #160
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 7862002 - 7862077
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||  |||||||||||||||| |||||||||||||| |||||||||| ||| | ||||| |||||||||||    
7862002 aacatgacactttgcaaatatcccctaaagttttgcacttacgtgcaaaatgtcccccgaacttaaaaatttatat 7862077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #161
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 9024717 - 9024796
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| || || |||||| |||||||||||||| |||||||| ||||||| ||||||||||||    
9024717 tgaacatgatgttttgcaaataccctcttgaagttatgcacttatgtgcataatgccccccaaacttaaaaatttatatt 9024796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #162
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 9360495 - 9360440
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||| | ||||||||||| |||||||||||||||||||||    
9360495 aacatgacgttttgcaaatacctcctgaagttttacacttatgtgcaaaatgcccc 9360440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #163
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 21312153 - 21312073
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||| ||||| |||| |||||||||||||||||||| ||||| |||||  ||| |||||||||||||||||    
21312153 tgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgtaaaataccccg--aacatgaaaatttatattttt 21312073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #164
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 36870234 - 36870307
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||| | ||||| |||||||||||    
36870234 aacataacgttttgcaaataccccctgaagtttt-cacttatgtgcaaaatgcccc-cgaactttaaaatttatat 36870307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #165
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 36870934 - 36870879
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||| |||||||||||||||| |||| |||||||||||||    
36870934 aacatgacgttttgcaaataccccctgaagttttgcatttatatgcaaaatgcccc 36870879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #166
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 37302508 - 37302563
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||||| |||||||||||| |||||||||||||||| ||||||||||||||||||    
37302508 aacatgatgttttgcaaatagcccctgaagttttgcagttatgtgcaaaatgcccc 37302563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #167
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 48083975 - 48083896
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| | ||||||||||||||||| |||||||||| || |   || ||||||||||||||||||    
48083975 aacatgacgttttgcaaatacctcctgaagttttgcacttgtgtgcaaaatacctcatgaatttgaaaatttatattttt 48083896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #168
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 48799796 - 48799870
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||| ||||||| ||||||||| ||||||||| | | |||||||||||||||||    
48799796 aacatgacgttttgcaaata-ccccttaagttttacacttatgtacaaaatgcctcccgaacttgaaaatttatat 48799870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #169
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 1861509 - 1861586
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||  ||||||||| ||||||||||||||||  ||| | |||||||||||||||||    
1861509 aacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaatttcccccgaacttgaaaatttatat 1861586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #170
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 23519455 - 23519534
Alignment:
99 aacatgacgttttgcaaatatcccc----tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| ||||    |||||||||||||||||||||||||||||||  ||| ||||||||||||||    
23519455 aacatgaagttttgcaaatacccccctcctgaagttttgcacttatgtgcaaaatgcccccaaaatttgaaaatttatat 23519534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #171
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 105 - 174
Target Start/End: Complemental strand, 25706056 - 25705986
Alignment:
105 acgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||| | | | |||||||||||||||||    
25706056 acgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgtctcccgaacttgaaaatttatat 25705986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #172
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 153
Target Start/End: Original strand, 29616853 - 29616907
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccc 153  Q
    |||||||||||||||||||| ||| | ||||||||||||||||||||||||||||    
29616853 aacatgacgttttgcaaataccccataaagttttgcacttatgtgcaaaatgccc 29616907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #173
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 29860065 - 29860142
Alignment:
99 aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||||  || |||||||||||||||||| |||||||||||  | | |||||||||||||||||    
29860065 aacatgacgttttgcaaatacatctcctgaagttttgcacttacgtgcaaaatgcatctcgaacttgaaaatttatat 29860142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #174
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 30318479 - 30318401
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| | |||||||||||  ||||||||||||||||||||  | |||  ||||||||||||    
30318479 tgaacatgacgttttgcaaatacctcctgaagttttatacttatgtgcaaaatgccccctagactaaaaaatttatatt 30318401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #175
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 36927576 - 36927634
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||| ||||||||||||||||||    
36927576 cccctgaaattttgcacttatgtgcaaaatgccccataaatttgaaaatttatattttt 36927634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #176
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 38392184 - 38392242
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||||||||||||| |||  ||||||||||||||||||||||    
38392184 cccctgaaattttgcacttatgtgcaaaatggcccctaaacttgaaaatttatattttt 38392242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #177
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 39633525 - 39633467
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
39633525 cccccgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttatattttt 39633467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #178
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 40278402 - 40278460
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||| ||  ||||||||||||||||||||||    
40278402 cccctgaaattttgcacttatgtgcaaaatgctccctaaacttgaaaatttatattttt 40278460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #179
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 99 - 172
Target Start/End: Complemental strand, 29798109 - 29798037
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    ||||||| |||||||||||| ||||| ||||||| ||||||||||||||||||||| | ||| |||||||||||    
29798109 aacatgatgttttgcaaataccccctaaagttttacacttatgtgcaaaatgcccc-cgaacatgaaaatttat 29798037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #180
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 30289576 - 30289519
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||||| | |||||||||||  ||||||||||||||||||||    
30289576 tgaacatgacgttttgcaaatacctcctgaagttttatacttatgtgcaaaatgcccc 30289519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #181
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 120 - 177
Target Start/End: Original strand, 36076691 - 36076748
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    |||||||| ||||||||||||||||||||||||||  |||||| ||||||||||||||    
36076691 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatttt 36076748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #182
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 38035736 - 38035671
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| |||||||||||||||||||||||||   |||||| |||||||||||||||    
38035736 caaataccccctgaaattttgcacttatgtgcaaaatgccctctaaacttaaaaatttatattttt 38035671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #183
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 109 - 178
Target Start/End: Complemental strand, 40220810 - 40220742
Alignment:
109 tttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||| |||||||||||||||||||| || ||||||| ||| | |||||||||||||||||||||    
40220810 tttgcaaata-cccctgaagttttgcacttacgtacaaaatgtcccccgaacttgaaaatttatattttt 40220742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #184
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 1613581 - 1613657
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| |||| |||||||||| |||||||||||||||||| |   |||||||||||||||||    
1613581 aacatgaggttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgcctcctgaacttgaaaatttatat 1613657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #185
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 6337022 - 6336946
Alignment:
99 aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||| |||||| || |||||||||||| |||||| |||||||||||||   |||||||||||||||||    
6337022 aacatgacgtttttcaaataccctcctgaagttttgtacttatatgcaaaatgccccctgaacttgaaaatttatat 6336946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #186
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 103 - 174
Target Start/End: Original strand, 9359727 - 9359799
Alignment:
103 tgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||| || ||||||||||| ||||||||| |||||||||   ||||||||||||||||||    
9359727 tgacgttttgcaaatattcctctgaagttttgaacttatgtgtaaaatgccctttaaacttgaaaatttatat 9359799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #187
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 15030956 - 15031033
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||  |||||||| |||| || || |||||||||    
15030956 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgc--aatgccccccaaatttaaatatttatatt 15031033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #188
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 26172379 - 26172323
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||    
26172379 aacatgacgttttgcaaataaccccctgaagttttacacttatgtgcaaaatgcccc 26172323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #189
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 39334376 - 39334324
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg 150  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||||    
39334376 aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg 39334324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #190
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 15739651 - 15739577
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| || ||||||| ||| |||| ||||||||||||||||||||||||||||||   |||||||||||||||||    
15739651 aacataacattttgcagata-ccccggaagttttgcacttatgtgcaaaatgccccttgaacttgaaaatttatat 15739577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #191
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 25490182 - 25490128
Alignment:
102 atgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||||||||||||||| ||||  |||||||||||||||||||||||||||||||    
25490182 atgacgttttgcaaatacccccactgaagttttgcacttatgtgcaaaatgcccc 25490128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #192
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 32825564 - 32825643
Alignment:
97 tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| ||||| || |||||||||||| |||||||||| || | || || ||||||||||||    
32825564 tgaacatgacgttttgcaaatatccccctaaaattttgcacttatatgcaaaatgctcctcgaatttaaaaatttatatt 32825643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #193
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 174
Target Start/End: Complemental strand, 42260266 - 42260192
Alignment:
102 atgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||| ||||  |||||||||||||||||||||||||| ||||   || ||||||||||||||    
42260266 atgacgttttgcaaataccccccttgaagttttgcacttatgtgcaaaataccccctgaatttgaaaatttatat 42260192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #194
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 43420737 - 43420662
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||  |||||  |||||| |||||||||||||||||| || | |||||||||||||||||    
43420737 aacatcacgttttgcaaatcccccctatagttttacacttatgtgcaaaatgctccccgaacttgaaaatttatat 43420662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #195
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 44097792 - 44097870
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||  |||||| |||||||||||||| |||||||||||||||||  | | ||||||||||||| |||||||    
44097792 aacatgacgtttgacaaataccccctgaagttttgtacttatgtgcaaaatgcttc-cgaacttgaaaatttgtattttt 44097870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #196
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 54284030 - 54283975
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| ||||||||||||||||||||||||||  |||||| |||||||||||||||    
54284030 ctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt 54283975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #197
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 4630660 - 4630738
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccc-cgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||| ||| ||||||||||||| ||||||||||||||||| |  ||| |||||||||||||||    
4630660 aacatgatgttttgcaaatacccctctgaagttttgcatttatgtgcaaaatgccctctgaaatttgaaaatttatatt 4630738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #198
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 4941069 - 4940987
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||| ||||| || || ||||||||||||||||||| |||||| ||| | ||||| |||||||||||||||    
4941069 tgaatatgacgttttgtaaataccctcttgaagttttgcacttatgtgtaaaatgtcccccgaacttaaaaatttatattttt 4940987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #199
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 101 - 174
Target Start/End: Complemental strand, 7862891 - 7862817
Alignment:
101 catgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||| |||| |||||| ||||| |||||||| ||||||||||||||||| |||  ||||||||||||||||||    
7862891 catgacattttacaaatacccccttgaagttttacacttatgtgcaaaatgtcccctaaacttgaaaatttatat 7862817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #200
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 36077213 - 36077155
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
36077213 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 36077155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #201
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 36928399 - 36928341
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
36928399 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 36928341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #202
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 40034308 - 40034254
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| || ||||||||||||||||||||||||||  ||||||||||||||||||    
40034308 cccctaaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttatat 40034254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #203
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 40279216 - 40279158
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
40279216 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 40279158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #204
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 41904671 - 41904617
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||| | ||||||||||||||||||||||||||  ||||||||||||||||||    
41904671 cccctggaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat 41904617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #205
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 42341856 - 42341914
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||| |||||||||||||||| ||||  ||||||||||||||||||||||    
42341856 cccctgaaattttacacttatgtgcaaaataccccctaaacttgaaaatttatattttt 42341914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #206
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 55082568 - 55082645
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||  |||||||||| |||||||||||||||||| |   |||||| ||||||||||    
55082568 aacatgacgttttgcaaataccccccctgaagttttgtacttatgtgcaaaatgccacctgaacttggaaatttatat 55082645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #207
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 119 - 172
Target Start/End: Complemental strand, 1565885 - 1565832
Alignment:
119 tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    ||||||| | ||||||||||||||||||||||||||  ||||||||||||||||    
1565885 tcccctggaattttgcacttatgtgcaaaatgccccataaacttgaaaatttat 1565832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #208
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 178
Target Start/End: Complemental strand, 22072828 - 22072752
Alignment:
102 atgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||| | || | |||||||||||||||||||||||||| |||  |||||| |||||||||||||||    
22072828 atgacgttttgcaaatcttcctttgaagttttgcacttatgtgcaaaatg-ccctaaaacttaaaaatttatattttt 22072752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #209
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 12213358 - 12213278
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| || ||||||||||| |||  ||||||||||| ||||||||||||||| ||| | | |||||||||||||||||||    
12213358 aacatcacattttgcaaatacccctatgaagttttgcccttatgtgcaaaatgtcccccgagcttgaaaatttatattttt 12213278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #210
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 120 - 168
Target Start/End: Complemental strand, 19538420 - 19538372
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaat 168  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||    
19538420 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaat 19538372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #211
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 23520026 - 23519974
Alignment:
122 cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| |||||||| | ||||||||||| |||||||    
23520026 cctgaagttttgcacttatgtgtaaaatgcctcccaaacttgaaagtttatat 23519974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #212
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 53139928 - 53139872
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||| |||||||||||||| |||| | |||||||||||||||||||||||||||||    
53139928 aacataacgttttgcaaatactcccttaaagttttgcacttatgtgcaaaatgcccc 53139872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #213
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 161
Target Start/End: Complemental strand, 6508437 - 6508374
Alignment:
99 aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaact 161  Q
    ||||| |||||||||||||||   ||||||||||||||||||||||||||||| ||| ||||||    
6508437 aacataacgttttgcaaatatttacctgaagttttgcacttatgtgcaaaatgtcccccaaact 6508374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #214
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 10663733 - 10663651
Alignment:
97 tgaacatgacgttttgcaaatatcccctga-agttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||||||||| ||||  | ||||||| |||||||||||||||||| | | ||||| ||| |||||||||||    
10663733 tgaatatgacgttttgcaaatacccccctacagttttgaacttatgtgcaaaatgcctcccgaacttaaaagtttatattttt 10663651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #215
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 10877878 - 10877796
Alignment:
97 tgaacatgacgttttgcaaatatcccctga-agttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||||||||| ||||  | ||||||| |||||||||||||||||| | | ||||| ||| |||||||||||    
10877878 tgaatatgacgttttgcaaatacccccctacagttttgaacttatgtgcaaaatgcctcccgaacttaaaagtttatattttt 10877796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #216
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 19537877 - 19537935
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  | |||| |||||||| ||||||    
19537877 cccctgaaattttgcacttatgtgcaaaatgccccttatacttaaaaatttagattttt 19537935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #217
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 30779079 - 30779133
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||||||||||||   ||||||||| |||||||    
30779079 cccctgaagttttgcacttaagtgcaaaatgccccctcaacttgaaattttatat 30779133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #218
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 34016953 - 34017011
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||| ||  |||||| |||||||| ||||||    
34016953 cccctgaaattttgcacttatgtgcaaaatgctccctaaacttaaaaatttagattttt 34017011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #219
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 150
Target Start/End: Complemental strand, 38351628 - 38351574
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg 150  Q
    ||||||||||||||| ||||||||| | |||||||||| ||||||||||||||||    
38351628 tgaacatgacgttttacaaatatcctcatgaagttttgtacttatgtgcaaaatg 38351574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #220
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 39632708 - 39632766
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||||||||||||||| |  |||||| |||||||| ||||||    
39632708 cccctgaaattttgcacttatgtgcaaaatgcctcataaacttaaaaatttagattttt 39632766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #221
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 40146354 - 40146296
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||  ||||||||||| |||| ||||||||| |||||||||||||||||||||    
40146354 tgaacatgaaattttgcaaatacccccctgaagtttttcacttatgtgcaaaatgcccc 40146296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #222
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 6955700 - 6955757
Alignment:
121 ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| ||||||||||||||||||| ||||||  |||||| |||||||| ||||||    
6955700 ccctgaaattttgcacttatgtgcaaattgccccctaaacttaaaaatttagattttt 6955757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #223
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 101 - 174
Target Start/End: Original strand, 23395965 - 23396037
Alignment:
101 catgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||| |||| | |||||||||||||||| || ||||||| | | | |||||||||||||||||    
23395965 catgacgttttgcaa-tatctcttgaagttttgcacttacgtacaaaatgtctcccgaacttgaaaatttatat 23396037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #224
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 38035162 - 38035227
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||| |||||||| |||  |||||| |||||||| ||||||    
38035162 caaataccccctgaaattttgcacttatgcgcaaaatgtcccataaacttaaaaatttagattttt 38035227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #225
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 38393015 - 38392950
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||| ||||||| ||  |||||| |||||||| ||||||    
38393015 caaataccccctgaaattttgcacttatgtgaaaaatgctccctaaacttaaaaatttagattttt 38392950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #226
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 97 - 148
Target Start/End: Original strand, 7972029 - 7972081
Alignment:
97 tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaa 148  Q
    |||||||||||||||| ||| | | ||||||||||||||||||||||||||||    
7972029 tgaacatgacgttttgtaaacaccgccctgaagttttgcacttatgtgcaaaa 7972081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #227
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 106 - 178
Target Start/End: Complemental strand, 55778198 - 55778126
Alignment:
106 cgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||| ||  |||| || ||||||||||||||||||| | |   |||||||||||||||||||||    
55778198 cgttttgcaaataccctttgaaattctgcacttatgtgcaaaatgtctcctgaacttgaaaatttatattttt 55778126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #228
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 106 - 178
Target Start/End: Complemental strand, 55842378 - 55842306
Alignment:
106 cgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||| ||  |||| || ||||||||||||||||||| | |   |||||||||||||||||||||    
55842378 cgttttgcaaataccctttgaaattctgcacttatgtgcaaaatgtctcctgaacttgaaaatttatattttt 55842306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #229
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 135
Target Start/End: Complemental strand, 56473753 - 56473717
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgca 135  Q
    |||||||||||||||||||| ||||||||||||||||    
56473753 aacatgacgttttgcaaataccccctgaagttttgca 56473717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #230
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 205128 - 205069
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttg-aaaatttatattttt 178  Q
    ||||| || |||||||||||||||||||||| |||  ||||||| |||||||||||||||    
205128 cccctaaaattttgcacttatgtgcaaaatgtcccttaaacttgaaaaatttatattttt 205069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #231
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 171
Target Start/End: Original strand, 1565099 - 1565150
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    |||||||| ||||||||||||||| ||||||||||  |||||| ||||||||    
1565099 cccctgaaattttgcacttatgtgtaaaatgccccttaaacttaaaaattta 1565150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #232
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 167
Target Start/End: Original strand, 6450251 - 6450298
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa 167  Q
    |||||||| ||||||||||||||||||||||||||  |||||| ||||    
6450251 cccctgaaattttgcacttatgtgcaaaatgccccctaaactttaaaa 6450298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #233
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 167
Target Start/End: Original strand, 19169452 - 19169499
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa 167  Q
    |||||||| ||||||||||||||||||||||||||  |||||| ||||    
19169452 cccctgaaattttgcacttatgtgcaaaatgccccataaactttaaaa 19169499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #234
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 100 - 174
Target Start/End: Original strand, 43419716 - 43419787
Alignment:
100 acatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||| ||||||| ||||||  |||| ||||||||||||||| ||||||||||||||  ||||| |||||||||||    
43419716 acattacgttttacaaatactccctaaagttttgcacttat-tgcaaaatgccccg--aactttaaaatttatat 43419787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #235
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 220774 - 220720
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| |||||||||||||||||||||| |||   |||||||||| ||||||    
220774 cccctgaaattttgcacttatgtgcaaaatgtcccttgaacttgaaaaattatat 220720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #236
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 112 - 174
Target Start/End: Complemental strand, 33617546 - 33617484
Alignment:
112 gcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| || ||||||||||||| |||||||||||||||||    ||||| |||||||||||    
33617546 gcaaataccctctgaagttttgcatttatgtgcaaaatgcccactgaacttaaaaatttatat 33617484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #237
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 35194149 - 35194226
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| || |  ||||||||||||||||| |||||||| | ||   |||||||||||||||||    
35194149 aacatgatgttttgcaaataccctccttgaagttttgcacttatatgcaaaatactccctgaacttgaaaatttatat 35194226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #238
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 154
Target Start/End: Original strand, 40033483 - 40033517
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||| ||||||||||||||||||||||||||    
40033483 cccctgaaattttgcacttatgtgcaaaatgcccc 40033517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #239
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 42342542 - 42342484
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||| |||||||||||||||| |||  |||||| |||||||| ||||||    
42342542 cccctgaaattttgaacttatgtgcaaaatgtcccataaacttaaaaatttaaattttt 42342484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #240
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 54445503 - 54445449
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| |||||||||||||||||||||| |||  |||||| |||||||| ||||||    
54445503 tgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaatttagattttt 54445449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #241
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 153
Target Start/End: Complemental strand, 6956219 - 6956186
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccc 153  Q
    |||||||| |||||||||||||||||||||||||    
6956219 cccctgaaattttgcacttatgtgcaaaatgccc 6956186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #242
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 174
Target Start/End: Complemental strand, 32465518 - 32465469
Alignment:
125 gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| ||||||  |||||||||||| | |||||||||||||||||    
32465518 gaagttttgaacttataagcaaaatgccccccgaacttgaaaatttatat 32465469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #243
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 171
Target Start/End: Original strand, 41610682 - 41610746
Alignment:
107 gttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    |||||||||||| |||| |||| |||| ||||||||||||||||| ||| ||||||| ||||||||    
41610682 gttttgcaaatacccccctgaaatttttcacttatgtgcaaaatgtcccccaaactt-aaaattta 41610746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #244
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 41904123 - 41904183
Alignment:
119 tcccctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||| |||| ||||||||||||||||| ||||  |||||| |||||||| ||||||    
41904123 tcccctgaaattttacacttatgtgcaaaatgcccccataaacttaaaaatttagattttt 41904183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #245
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 42987160 - 42987224
Alignment:
114 aaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| |||||||| |||| |||||| |||||||||||| |  |||||| |||||||| ||||||    
42987160 aaataccccctgaaattttacacttacgtgcaaaatgcctcttaaacttaaaaatttagattttt 42987224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 172; Significance: 4e-92; HSPs: 235)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 172; E-Value: 4e-92
Query Start/End: Original strand, 320 - 583
Target Start/End: Complemental strand, 40126094 - 40125828
Alignment:
320 tgattaactgagtacatactaatattatatgacatatattt--aattgattatgcaggatgcatgcagatgctttctcattgagagtggtttcgcgctgt 417  Q
    ||||||| ||||||||| |||||||||||||||||||||||  ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||    
40126094 tgattaattgagtacatcctaatattatatgacatatatttttaattgattatgcaggatgcatgcagatactttctcattgagagtggtttcgcgttgt 40125995  T
418 tcgttgcatttctaatcaatgttgcaatgatttatgtgactggtactgtttgcaaagctgatgatacttctggagagaatactgatcgttgcaatgatat 517  Q
    | ||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||||||| |||||||||||||  ||||||||||||||||||    
40125994 ttgttgcatttctaatcaatgttgcaatgatttctgtgactggcactgtttgcaaggctgatgatatttctggagagaatgttgatcgttgcaatgatat 40125895  T
518 tacccttgactttgcttctttcattctcctagtttctaatttagttc-aatttgcaactattatggt 583  Q
    ||||||| |||  ||||||||| ||||||  ||| ||||||||||||  ||||||||||||||||||    
40125894 tacccttaactccgcttctttccttctccaggttcctaatttagttcgcatttgcaactattatggt 40125828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 174 - 309
Target Start/End: Complemental strand, 40126571 - 40126446
Alignment:
174 tttttgggatgtttgggcatatacacaggtgaggaagttggaactgctgatttcaatttcaattctagtatttgtaatggcggcatgtttctttggtgaa 273  Q
    |||||||||||||||||||||    |||||||||||||||||||||||||||||||||      ||||||||||||||||| ||||||||||||||||||    
40126571 tttttgggatgtttgggcata----caggtgaggaagttggaactgctgatttcaatt------ctagtatttgtaatggctgcatgtttctttggtgaa 40126482  T
274 ttgagctatggaaaaccccctcctaaaggagtaatt 309  Q
    |||||||||| |||||||||| ||||||||||||||    
40126481 ttgagctatgtaaaaccccctgctaaaggagtaatt 40126446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39669535 - 39669457
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
39669535 tgaacatgacgttttacaaatatcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 39669457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 43727765 - 43727687
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||| ||||||||||||    
43727765 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttatatt 43727687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 35154026 - 35154104
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
35154026 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 35154104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36027982 - 36027905
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
36027982 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 36027905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13737704 - 13737624
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
13737704 tgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgtgcaaaatgccccccaaacttcaaaatttatatt 13737624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 31585957 - 31586037
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
31585957 tgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 31586037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 97 - 176
Target Start/End: Original strand, 9718048 - 9718128
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
9718048 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattt 9718128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 883510 - 883589
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||    
883510 tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgtaaaatgccccccaaacttaaaaatttatatt 883589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 884119 - 884040
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
884119 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 884040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 3370748 - 3370669
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
3370748 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 3370669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 10120646 - 10120567
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
10120646 tgaacatgacgttttgcaaatactccccagaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 10120567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13341729 - 13341808
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
13341729 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 13341808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17053294 - 17053373
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||  ||||||| ||||||||||||    
17053294 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt 17053373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 20495436 - 20495515
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
20495436 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 20495515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 23323952 - 23323873
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
23323952 tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 23323873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 23781747 - 23781668
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
23781747 tgaacatgacgttttgcaaatatccccctcaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 23781668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24828233 - 24828154
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
24828233 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 24828154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32950968 - 32950889
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
32950968 tgaacatgacattttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 32950889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 44518388 - 44518467
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
44518388 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 44518467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 52171671 - 52171592
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
52171671 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 52171592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 23323342 - 23323420
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||    
23323342 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 23323420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36260111 - 36260033
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| |||||||||||||||||  |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
36260111 tgaatatgacgttttgcaaatactccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt 36260033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36736010 - 36736088
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| || ||||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
36736010 tgaacatgacgttttgcaaataccctctgaatttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 36736088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37704328 - 37704250
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
37704328 tgaacatgacattttgcaaataccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 37704250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 40783393 - 40783315
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| ||||||| ||| ||||||||    
40783393 tgaacatgacgttttgcaaatatcccccgaaattttgcacttatgtgcaaaatgccccccaaacttaaaagtttatatt 40783315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42248945 - 42248867
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| | ||||| ||||||||||||    
42248945 tgaacatgacgttttgcaaataccccctaaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatatt 42248867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 44518996 - 44518918
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| |||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||    
44518996 tgaacatgacattttgcaaataccccctgaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttatatt 44518918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 54602262 - 54602340
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||| |||||||||| ||||||||||||||||||||||||||||||  |||||||||||||||||||||    
54602262 aacataacgttttgtaaatatcccccgaagttttgcacttatgtgcaaaatgccccataaacttgaaaatttatatttt 54602340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 5152507 - 5152587
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
5152507 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 5152587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 9103955 - 9103878
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||  ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
9103955 tgaacatgaaattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 9103878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23581856 - 23581936
Alignment:
97 tgaacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||||  ||||||||||||||||||||||| |||||| ||||||| ||||||||||||    
23581856 tgaacatgacgttttgcaaatatcccctctgaagttttgcacttatgtgcaaactgccccccaaacttaaaaatttatatt 23581936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24086837 - 24086757
Alignment:
97 tgaacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||  ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
24086837 tgaacatgacgttttgcaaataccctccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 24086757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36736619 - 36736539
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
36736619 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 36736539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 11652989 - 11653069
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| | |||||||||||||||| ||||    
11652989 aacatgacgttttgcaaatactcccctgaagtttttcacttatgtgcaaaatgccccccgaacttgaaaatttataatttt 11653069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 50672576 - 50672496
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||   |||||||||||||||||||||    
50672576 aacatgacgttttgcaaatatccccctgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaatttatattttt 50672496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4238329 - 4238251
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||| ||||||||||||    
4238329 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgcccc-cacacttaaaaatttatatt 4238251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13342338 - 13342259
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || ||||||||||||    
13342338 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt 13342259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23908482 - 23908561
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
23908482 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 23908561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25067677 - 25067756
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || ||||||||||||    
25067677 tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt 25067756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 31582727 - 31582806
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||| ||||||| ||||||||||||    
31582727 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatatgcaaaatgccccccaaacttaaaaatttatatt 31582806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31586570 - 31586491
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
31586570 tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 31586491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 36027106 - 36027184
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
36027106 aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 36027184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39668924 - 39669002
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
39668924 tgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 39669002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40163171 - 40163250
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
40163171 tgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 40163250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42390118 - 42390040
Alignment:
97 tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||    
42390118 tgaacatgacgttttgcaaatattcccctgaagttttgcacttatgtgtaaaatgcccc-caaacttaaaaatttatatt 42390040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 47799127 - 47799206
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||  |||||| ||||||||||||    
47799127 tgaacatgacgttttgcaaatactcccctgaagttttgcgcttatgtgcaaaatgcccccaaaacttaaaaatttatatt 47799206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 47799730 - 47799652
Alignment:
97 tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
47799730 tgaacatgacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 47799652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 49255783 - 49255862
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
49255783 tgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 49255862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 49256392 - 49256313
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||  |||||| ||||||||||||    
49256392 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccccgaaacttaaaaatttatatt 49256313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 52171064 - 52171143
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
52171064 tgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 52171143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 55153486 - 55153565
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
55153486 tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 55153565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 55154095 - 55154016
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||| |||| ||||||| ||||||||||||    
55154095 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaatttatatt 55154016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 18073890 - 18073812
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| ||||||| |||||||| |||||||||||| ||||||| ||||||||||||    
18073890 tgaacatgacgttttgcaaataccccctaaagtttttcacttatgcgcaaaatgcccctcaaacttaaaaatttatatt 18073812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 33305909 - 33305831
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| ||||| | ||||||||||| ||||||||||||||||||||| ||||||| ||||||||||||    
33305909 tgaacatgacgttttgtaaataccacctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt 33305831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 52394554 - 52394636
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| |||  ||||||||||||||||||||||||||||||| | ||||| |||||||||||||||    
52394554 tgaacatgacgttttgcaaatacccctatgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatattttt 52394636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 54627160 - 54627238
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| |||||||||||| ||||||||||||||||||||||  ||||||| |||||||||||||    
54627160 aacataacgttttgcaaataacccctgaagtttcgcacttatgtgcaaaatgcccccaaaacttggaaatttatatttt 54627238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 102 - 178
Target Start/End: Complemental strand, 7580532 - 7580456
Alignment:
102 atgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||| ||||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
7580532 atgacgttttgtaaatacccctctgaagttttgcacttatgtgcaaaatgcccc-caaacttgaaaatttatattttt 7580456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 103 - 175
Target Start/End: Original strand, 10656218 - 10656291
Alignment:
103 tgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
10656218 tgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 10656291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 10657117 - 10657038
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
10657117 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 10657038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 29006856 - 29006776
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  |||||||||||||||||||||||||||| || ||||||| ||||||||||||    
29006856 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgctccccaaacttaaaaatttatatt 29006776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38599000 - 38599080
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||| ||||||||||||||||||||| ||||||| ||||||||||||    
38599000 tgaacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt 38599080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 40065621 - 40065701
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| ||||  |||||||||||||||||||||||||||||||  |||||||||||||||||||||    
40065621 aacataacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatttt 40065701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 53178376 - 53178453
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| || |||||||||    
53178376 aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaatatttatatt 53178453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 14509309 - 14509385
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||  | |||||||||||||||||    
14509309 aacatgacgttttgcaaatatccccctgaagttttacacttatgtgcaaaatgccctccgaacttgaaaatttatat 14509385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 24782223 - 24782299
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| ||||||| |||||| ||||||||||||||||||||||||||||||| |||  |||||||||||||||||||    
24782223 aacataacgttttccaaataccccctgaagttttgcacttatgtgcaaaatgtcccttaaacttgaaaatttatatt 24782299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 26839291 - 26839366
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| | |||||||||||||||||    
26839291 aacatgacgttttgcaaatactcccctgaagttttacacttatgtgcaaaatgcccc-cgaacttgaaaatttatat 26839366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 172
Target Start/End: Original strand, 42855876 - 42855952
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    |||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| ||||||| |||||||||    
42855876 tgaacatgacgttttgcaaatacccccctgaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttat 42855952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 54492852 - 54492932
Alignment:
99 aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||  |||||||||||||||||||||||||||||||| |   |||||||||||||||||||||    
54492852 aacatgacgttttgcaaatatttccctgaagttttgcacttatgtgcaaaatgccgcctgaacttgaaaatttatattttt 54492932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 103 - 170
Target Start/End: Complemental strand, 1033787 - 1033720
Alignment:
103 tgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||| ||||||    
1033787 tgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccgaacttgcaaattt 1033720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 10120036 - 10120114
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
10120036 tgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 10120114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23781138 - 23781217
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| ||||| || ||||||||||||||||||||||||||| ||||||| ||||||||||||    
23781138 tgaacataacgttttgcaaatacccccttaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 23781217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24814208 - 24814286
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
24814208 tgaatatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 24814286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 96 - 179
Target Start/End: Complemental strand, 26839486 - 26839403
Alignment:
96 atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttg 179  Q
    |||||||||| ||||||||||||||||||||||||||||||||| | |||||||| ||| |||| || ||||||||||| ||||    
26839486 atgaacatgaagttttgcaaatatcccctgaagttttgcacttacgagcaaaatgtcccccaaatttaaaaatttatatgtttg 26839403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36791715 - 36791636
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| ||||| |||| |||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
36791715 tgaacatgacgttttgtaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 36791636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42389511 - 42389590
Alignment:
97 tgaacatgacgttttgcaaatatcccctg-aagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||  ||||||||||||||||||||||||||||  ||||||| ||||||||||||    
42389511 tgaacatgacgttttgcaaataccccctttaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt 42389590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 46976820 - 46976741
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||  |||||| ||||||||||||    
46976820 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatttgcaaaatgccccctaaacttaaaaatttatatt 46976741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 49527924 - 49527845
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| || ||||||||||||||||||||||| ||| ||||||| ||||||||||||    
49527924 tgaacatgacgttttgcaaatacccccttaaagttttgcacttatgtgcaaaatgtcccccaaacttcaaaatttatatt 49527845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 55482320 - 55482242
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||    |||||||||||||||||||||    
55482320 aacatgacgttt-gcaaatatcccctgaagttttgcacttatgtgcaaaatgtccactgaacttgaaaatttatattttt 55482242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 4584135 - 4584213
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| |||| |||||||||||||||||||||||||| |||| ||||||| |||||||||||    
4584135 tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaattccccccaaacttaaaaatttatat 4584213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 5153119 - 5153041
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||| ||||||  || ||||||| ||||||||||||    
5153119 tgaacatgacgttttgcaaataccccccgaagttttgcacttatgtgaaaaatgttccccaaacttaaaaatttatatt 5153041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 100 - 175
Target Start/End: Original strand, 6071110 - 6071187
Alignment:
100 acatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||| |||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
6071110 acatgatgttttgcaaataccccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 6071187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 19238346 - 19238424
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| ||| ||||||||||||||||||| ||||||||||| | ||||| ||||||||||||    
19238346 tgaacatgacattttgcaaataccccttgaagttttgcacttatgttcaaaatgcccccccaacttaaaaatttatatt 19238424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 19961647 - 19961724
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| | | ||||||||||||||||||||||||||||||||| ||||| | ||||||||||||    
19961647 tgaacatgacgttttgcaaacacctcctgaagttttgcacttatgtgcaaaatgcccc-caaacataaaaatttatatt 19961724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 20496046 - 20495968
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| |||||||  |||||||||||    
20496046 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaactt--aaatttatatt 20495968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 31584819 - 31584900
Alignment:
99 aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||  ||||||||| ||||||||||||||||||||||||||   | |||||||||||||||||||    
31584819 aacatgacgttttgcaaatacctcccctgaaattttgcacttatgtgcaaaatgccccctgagcttgaaaatttatattttt 31584900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 170
Target Start/End: Original strand, 34503538 - 34503612
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    |||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||| | |||||||||||||    
34503538 tgaacatgacgttttgcaaataccctcctgaagttttgcacttatatgcaaaatgccccccgaacttgaaaattt 34503612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 35154633 - 35154555
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| ||| |||||||||||||||||||||||||| |||  ||||||| ||||||||||||    
35154633 tgaacataacgttttgcaaataccccatgaagttttgcacttatgtgcaaaataccctccaaacttaaaaatttatatt 35154555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 172
Target Start/End: Complemental strand, 38599610 - 38599534
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| |||||||||    
38599610 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttat 38599534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 23909092 - 23909012
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||| ||||||||||||  |||||||||||| |||||||||||||||||| || |||| ||||||||||||    
23909092 tgaacatgacgtttggcaaatatcccccctgaagttttgcatttatgtgcaaaatgccccccatacttaaaaatttatatt 23909012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24086226 - 24086306
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||| ||| ||||||| ||| ||||||||    
24086226 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaattttatatt 24086306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31583337 - 31583257
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||| ||||||||| ||||||||||| ||||||| ||||||||||||    
31583337 tgaacatgacgttttgcaaataccccccctgaagttttacacttatgtacaaaatgccccccaaacttaaaaatttatatt 31583257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43727157 - 43727237
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||| | | ||||||| ||||||||||||    
43727157 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtctcccaaacttaaaaatttatatt 43727237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 52961049 - 52961125
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||| |||||||  ||||||||||    
52961049 tgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatacccc-caaacttacaaatttatat 52961125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 53628193 - 53628113
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||  |||  ||||||||||||||||||| ||||||||||| ||||||| ||||||||||||    
53628193 tgaacatgacgttttgcaaatacaccccatgaagttttgcacttatgttcaaaatgccccccaaacttaaaaatttatatt 53628113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 103 - 174
Target Start/End: Original strand, 8014742 - 8014814
Alignment:
103 tgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||| |||| |||||||||||||| |||||||||||||||| ||||||| |||||||||||    
8014742 tgacgttttgcaaatacccccctgaagttttgcactgatgtgcaaaatgccccccaaacttaaaaatttatat 8014814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 35234976 - 35235052
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||   |||||||||||||||||    
35234976 aacatgacgttttgcaaatactcccctgaagttttgtacttatgtacaaaatgccccctgaacttgaaaatttatat 35235052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13737088 - 13737167
Alignment:
97 tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| ||||||||||||||  ||||| ||||||||||||||| ||||||||||||| ||||||| ||||||||||||    
13737088 tgaacatcacgttttgcaaatacacccctaaagttttgcacttatttgcaaaatgccccccaaacttaaaaatttatatt 13737167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 20186535 - 20186613
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| || | |||||||    
20186535 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaacaattatatt 20186613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21628007 - 21627928
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||| | ||||  |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
21628007 tgaacataacgttttgcaaacaaccccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 21627928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 33305287 - 33305365
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||  | ||||||| ||||||||||||    
33305287 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcttc-caaacttaaaaatttatatt 33305365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 34921424 - 34921475
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg 150  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||    
34921424 aacatgacgttttgcaaatatcccttgaagttttgcacttatgtgcaaaatg 34921475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 35235894 - 35235815
Alignment:
99 aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| || |||||||||||||||||||| | ||||||||||  |||||||||||||||||||||    
35235894 aacataacgttttgcaaataccctcctgaagttttgcacttatgcgaaaaatgccccctaaacttgaaaatttatatttt 35235815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36259504 - 36259583
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| || |||||||||    
36259504 tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaagatttatatt 36259583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 40514901 - 40514823
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| | ||||| ||||||||||||    
40514901 tgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-cgaacttaaaaatttatatt 40514823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 45258674 - 45258595
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||| | ||||||||||||||| | ||||| ||||||||||||    
45258674 tgaacatgacgttttgcaaatacccccctgaagttttgcacatgtgtgcaaaatgccccccgaacttaaaaatttatatt 45258595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 19239906 - 19239828
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| |||||||||||||||||||||||||| || | | || || ||||||||||||    
19239906 tgaacatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatacctcccgaatttaaaaatttatatt 19239828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24376853 - 24376775
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||||  | |||||||||||| |||||||||||||||||| ||||||  ||||||||||||    
24376853 tgaacatgacattttgcaaatatttcatgaagttttgcatttatgtgcaaaatgccccccaaactcaaaaatttatatt 24376775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 35234766 - 35234686
Alignment:
99 aacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||||  ||||||||||| ||||||||||||||||||  |||||| |||||||||||||||    
35234766 aacatgacgttttgcaaataccccctctgaagttttgcaattatgtgcaaaatgcccc-taaacttaaaaatttatattttt 35234686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 38667271 - 38667329
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
38667271 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 38667329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 40791484 - 40791563
Alignment:
99 aacatgacgttttgcaaata----tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||||     |||||||||||||||||||||||||||||||||||   |||||||||||||||||    
40791484 aacatgacgttttgcaaataccccccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatat 40791563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42248072 - 42248149
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||| |||| |||||||||||||||| |||| | ||||||||||| ||||||    
42248072 tgaacatgacgttttgcaaataccccctgaaattttacacttatgtgcaaaatacccc-cgaacttgaaaatctatatt 42248149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 42856753 - 42856676
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||  ||||||||||||||||||||||||||| |||  |||||| |||||||||||    
42856753 aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtccccaaaacttaaaaatttatat 42856676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 9718654 - 9718578
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||| |||| || ||||||||||||    
9718654 aacatgacgttttacaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaa-tttaaaatttatatt 9718578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 11653774 - 11653717
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||    
11653774 tgaacatgacgttttgcaaataccctctgaagttttgcacttatgtgcaaaatacccc 11653717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 98 - 162
Target Start/End: Original strand, 29006659 - 29006724
Alignment:
98 gaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaactt 162  Q
    ||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||| |||||||    
29006659 gaacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccccccaaactt 29006724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 34941655 - 34941575
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||   |||||||||| || ||||||||||||||||||| | ||||||| ||||||||||||    
34941655 tgaacatgacgttttgcaaatactccccctgaagtcttacacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 34941575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 53627316 - 53627392
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||| ||||| | |||||||| |||||||||||||||||||| ||||||| ||||||||||||    
53627316 aacatgacgttttgcaaatgtccccctaaagttttgaacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 53627392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 168
Target Start/End: Original strand, 987265 - 987337
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaat 168  Q
    ||||||||| |||||||||||| ||||| |||||||||||||||| ||||||||||||| |||||| ||||||    
987265 tgaacatgatgttttgcaaatacccccttgaagttttgcacttatatgcaaaatgccccccaaactggaaaat 987337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 20819355 - 20819431
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||   ||||| |||||||||||    
20819355 aacatgacgttttgcaaatacccccttgaagttttgtacttatgtgcaaaatgccccctgaacttaaaaatttatat 20819431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 29589024 - 29588945
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| | | ||||||||||||||||||||||||||||  |||  |||||||||||||||||||||    
29589024 aacatgacgttttgcaaatacttctctgaagttttgcacttatgtgcaaaatg-tccgtgaacttgaaaatttatattttt 29588945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 32751738 - 32751662
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |   || ||||||||||||||    
32751738 aacatgacgttttgcaaatactcccctgaagttttgtacttatgtgcaaaatgcctcctgaatttgaaaatttatat 32751662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 40066541 - 40066465
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||| |||| |||||||||| |||||||| |||||||||||  ||||||||||||||||||    
40066541 aacatgacattttgcaaatacccccctgaagttttgtacttatgttcaaaatgccccctaaacttgaaaatttatat 40066465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 44405335 - 44405260
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||   ||||| ||||||||||||    
44405335 aacatgacgttttgcaaata-cccctaaagttttgcacttatgtgcaaaatgtcccctgaacttaaaaatttatatt 44405260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 54603177 - 54603101
Alignment:
99 aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| |||||||||||||  |||||||||||| ||||||||||||||||||||   |||||||||||||||||    
54603177 aacatgacattttgcaaatatcttcctgaagttttgtacttatgtgcaaaatgccccatgaacttgaaaatttatat 54603101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 55481472 - 55481551
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||||| ||||||||||| ||||  ||||||||||||||||||||||||||| |||   |||||||||||||||||||    
55481472 aacatgacattttgcaaatacccccactgaagttttgcacttatgtgcaaaatgtcccctgaacttgaaaatttatattt 55481551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 113 - 172
Target Start/End: Original strand, 1586977 - 1587036
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    |||||| |||||||| ||||||||||||||||||||||||||  ||||||||||||||||    
1586977 caaataccccctgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttat 1587036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 2445198 - 2445123
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| || || ||||||||||||||||||||||||||  | | |||||||||||||||||    
2445198 aacatgaagttttgcaaatacccactaaagttttgcacttatgtgcaaaatgcttccctaacttgaaaatttatat 2445123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6071731 - 6071650
Alignment:
97 tgaacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| ||||   ||||||||||||||||||||||||||||||   |||||| ||||||||||||    
6071731 tgaacatgacattttgcaaatacccccccctgaagttttgcacttatgtgcaaaatgccctcaaaacttaaaaatttatatt 6071650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 20189508 - 20189429
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| |||| |||||| |||| ||||||||||||||||||||||||||| ||| ||||| | ||||||||||||    
20189508 tgaacatgacattttacaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacataaaaatttatatt 20189429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38771764 - 38771685
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||  ||  |||||| ||||||||||||    
38771764 tgaacatgacgttttgcaaatacccccttgaatttttgcacttatgtgcaaaatgttcccaaaacttaaaaatttatatt 38771685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40782787 - 40782865
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| || |||||||||| |||||||||||||||||| | ||||| ||||||||||||    
40782787 tgaacatgacgttttgcaaatacccctctaaagttttgcatttatgtgcaaaatgcccc-cgaacttaaaaatttatatt 40782865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 41222638 - 41222559
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||| | ||  ||||||||||||||||||||||||||||| ||||||| ||||| | |||||||    
41222638 aacatgacattttgcaaatacctccctaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatatctattttt 41222559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 42803137 - 42803059
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgc-aaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| ||| ||||||||||||||| |||||| ||||||||||  ||||||||||||||||||    
42803137 tgaacatgacgttttgcaaataccccgctgaagttttgcactgatgtgcaaaaatgcccc-aaaacttgaaaatttatat 42803059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 45712546 - 45712597
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg 150  Q
    ||||||| |||||||||||| |||||||||||||||||||||||||||||||    
45712546 aacatgatgttttgcaaataccccctgaagttttgcacttatgtgcaaaatg 45712597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 52961628 - 52961574
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
52961628 cccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 52961574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #138
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 54801224 - 54801149
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| ||||||||||||||  | |||||||||||||||||||||||||||||| | | |||||||||| ||||||    
54801224 aacatcacgttttgcaaatactctctgaagttttgcacttatgtgcaaaatgccacccgaacttgaaaaattatat 54801149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #139
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 3021220 - 3021278
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||||||||||    
3021220 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt 3021278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #140
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 3937725 - 3937783
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||| ||||||||||    
3937725 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaaattatattttt 3937783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #141
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 4070458 - 4070400
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||| ||||  ||||||||||||||||||||||    
4070458 cccctgaaattttgcacttatgtgcaaaataccccctaaacttgaaaatttatattttt 4070400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #142
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 7579943 - 7580024
Alignment:
99 aacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| ||||||||||||||   |||||||||||||||||||||||||||||||| || |||| || ||||||||| |||||    
7579943 aacataacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgctccccaaaattaaaaatttatcttttt 7580024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #143
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 14899392 - 14899338
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
14899392 tgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 14899338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #144
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 102 - 175
Target Start/End: Original strand, 21627403 - 21627477
Alignment:
102 atgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| ||||||||||| |||| |||||||||||||||||||| |||||| ||| ||||||| ||||||||||||    
21627403 atgacattttgcaaatacccccctgaagttttgcacttatgtgaaaaatgtcccccaaacttaaaaatttatatt 21627477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #145
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 25068297 - 25068239
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||||    
25068297 tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc 25068239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #146
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 169
Target Start/End: Complemental strand, 31585270 - 31585201
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt 169  Q
    |||||||||||||||||||||||||  | |||||||| ||||||||||||||||||  |||||||||||||    
31585270 aacatgacgttttgcaaatatcccccca-gttttgcagttatgtgcaaaatgccccctaaacttgaaaatt 31585201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #147
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 36951844 - 36951786
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||||||||||    
36951844 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt 36951786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #148
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 40009443 - 40009524
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||  |||||||||||| |||||| ||||||||| |   |||||||||||||||||||||    
40009443 aacatgacattttgcaaatatcccccctgaagttttgcatttatgtacaaaatgcctcatgaacttgaaaatttatattttt 40009524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #149
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 49316193 - 49316247
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||    
49316193 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat 49316247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #150
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 150
Target Start/End: Complemental strand, 52395116 - 52395062
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg 150  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||    
52395116 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg 52395062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #151
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 10473756 - 10473691
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| ||| |||| ||||||||||||||||||||||||||  |||||| |||||||||||||||    
10473756 caaataccccttgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt 10473691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #152
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 33982109 - 33982044
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
33982109 caaataccccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaatttagattttt 33982044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #153
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 37703723 - 37703799
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||| ||||||||||| |||| ||||||||||||||||||||| ||||||||| |||| || ||||||||||||    
37703723 aacatgacattttgcaaatacccccctgaagttttgcacttatgtgc-aaatgccccccaaatttaaaaatttatatt 37703799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #154
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 43354505 - 43354440
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
43354505 caaatatcgcctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 43354440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #155
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 45257965 - 45258044
Alignment:
97 tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| ||||||||||||  |||||||||||||| ||||||||||||||||| ||| ||||||| ||||| ||||||    
45257965 tgaacatgatgttttgcaaatacctcccctgaagttttacacttatgtgcaaaatgtccc-caaacttaaaaatctatatt 45258044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #156
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 1092147 - 1092223
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||| ||||||||||||||| |||| |||||||||| |||||||||||||||| |||   |||||||||||||||||    
1092147 aacaagacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgtcccctgaacttgaaaatttatat 1092223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #157
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 172
Target Start/End: Complemental strand, 4490354 - 4490279
Alignment:
99 aacatgacgttttgcaaatatc--ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    |||||||| |||||||||||||  ||||||||||| ||||||||||||||||||  |  |||||||||||||||||    
4490354 aacatgacattttgcaaatatctcccctgaagtttagcacttatgtgcaaaatgttctccaaacttgaaaatttat 4490279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #158
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 24783133 - 24783057
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||  ||||  ||||||||| ||||||||||||||||||||   |||||||||||||||||    
24783133 aacatgacgttttgcaaattcccccccgaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttatat 24783057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #159
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 32750817 - 32750893
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| |||||||||| |||||||||||||||||| |   ||||||||| |||||||    
32750817 aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgcctcatgaacttgaaattttatat 32750893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #160
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 107 - 178
Target Start/End: Original strand, 37332741 - 37332813
Alignment:
107 gttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||| ||||| |||||||||||||| |||||||||||||   | |||||||||||||||||||||    
37332741 gttttgcaaatacccccttgaagttttgcacttgtgtgcaaaatgccttccgaacttgaaaatttatattttt 37332813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #161
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 39285073 - 39285125
Alignment:
122 cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||| ||||||||||||||||||||||||||  ||||||||||||||||||    
39285073 cctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat 39285125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #162
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 40792353 - 40792273
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||| |||| |||||||||||| |||| |||||||||||||  ||||||||||||| || |||||    
40792353 aacatgacattttgcaaatacccccctgaagttttgcagttatatgcaaaatgccccctaaacttgaaaattcattttttt 40792273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #163
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 46651129 - 46651077
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg 150  Q
    ||||||||||||||||||||||||| |||||||||| ||||||||||||||||    
46651129 aacatgacgttttgcaaatatccccctgaagttttgtacttatgtgcaaaatg 46651077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #164
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 9103383 - 9103434
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg 150  Q
    |||||||||||||||||||| ||||||| ||||| |||||||||||||||||    
9103383 aacatgacgttttgcaaatagcccctgaggttttacacttatgtgcaaaatg 9103434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #165
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 107 - 178
Target Start/End: Complemental strand, 34922103 - 34922033
Alignment:
107 gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||| || ||||||||||||||||||||||||||||| ||   ||||||||||||||| |||||    
34922103 gttttgcaaata-cctctgaagttttgcacttatgtgcaaaatgctcccataacttgaaaatttatgttttt 34922033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #166
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 35233874 - 35233949
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||| ||||||||||||| ||| || | |||||||||||||||||||||| |||   |||||||||||||||||    
35233874 aacatggcgttttgcaaataccccatggaattttgcacttatgtgcaaaatgtcccttgaacttgaaaatttatat 35233949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #167
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 45148944 - 45148999
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| |||||||||||||||||||||||||   ||||||||||||||||||||||    
45148944 ctgaaattttgcacttatgtgcaaaatgccctctaaacttgaaaatttatattttt 45148999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #168
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 50314407 - 50314352
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||| |||||||||||||| |||||||| ||||||||||||||||||||| ||||    
50314407 aacatcacgttttgcaaataccccctgaaattttgcacttatgtgcaaaatacccc 50314352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #169
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 100 - 178
Target Start/End: Complemental strand, 54493616 - 54493537
Alignment:
100 acatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||| ||||| | |||| |||||||||||||||||||||||||| ||   ||||| |||||||||||||||    
54493616 acatgacgttttgtaaatacctccctcaagttttgcacttatgtgcaaaatgctccctcaacttaaaaatttatattttt 54493537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #170
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 1587811 - 1587753
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
1587811 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 1587753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #171
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 22847846 - 22847792
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| |||| |||||||||||||||||||||  ||||||||||||||||||||||    
22847846 tgaaattttacacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 22847792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #172
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 38667767 - 38667709
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
38667767 cccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaatttagattttt 38667709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #173
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38770432 - 38770508
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| |||||||||||||||| ||||||||||||||||||||| | |||||||| ||  |||||| ||||||||||||    
38770432 tgaacctgacgttttgcaaata-cccctgaagttttgcacttatatacaaaatgctcc-taaacttaaaaatttatatt 38770508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #174
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 40278263 - 40278317
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| || ||||||||||||||||||||||||||  ||||||||||||||||||    
40278263 cccctaaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat 40278317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #175
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 43914651 - 43914601
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||| ||||||||||||||||||||||||||  ||||||||||||||||||    
43914651 tgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttatat 43914601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #176
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 46975973 - 46976049
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| ||| ||||||||||||||||||||||||||| ||| | ||||| |||||| |||||    
46975973 tgaacatgacgtttttcaaata-cccatgaagttttgcacttatgtgcaaaatgtccc-ccaacttaaaaattaatatt 46976049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #177
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 49316738 - 49316680
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
49316738 cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt 49316680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #178
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 55117176 - 55117099
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| | |||||| |||| ||||||| |||||||| |||| ||||||| ||||||||||||    
55117176 tgaacatgacgttttacaaatacctcctgaatttttacacttatttgcaaaatacccc-caaacttaaaaatttatatt 55117099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #179
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 126 - 175
Target Start/End: Complemental strand, 987894 - 987845
Alignment:
126 aagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| |||||||||||||||||| ||||||| ||||||||||||    
987894 aagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttatatt 987845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #180
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 13268585 - 13268650
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||| ||| ||||||||||||||||||  ||| ||||||||||||||||||    
13268585 caaataccccctgaaatttggcatttatgtgcaaaatgccccctaaatttgaaaatttatattttt 13268650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #181
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 97 - 153
Target Start/End: Complemental strand, 39172476 - 39172419
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccc 153  Q
    ||||||||| |||||||||||| |||| |||| |||||||||||||||||||||||||    
39172476 tgaacatgatgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccc 39172419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #182
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 9667281 - 9667205
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||  |||| | |||||||||||||||||| | ||||||||||||| |  ||||||||||||||||    
9667281 aacatgacgttttgttaatacttccctgaagttttgcacttctatgcaaaatgccccccggacttgaaaatttatat 9667205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #183
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 174
Target Start/End: Original strand, 29587242 - 29587309
Alignment:
107 gttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| ||| ||||||||||||||||||||| |||||||||| || | |||||||||||||||||    
29587242 gttttgcaactattcccctgaagttttgcacttatttgcaaaatgctcc-cgaacttgaaaatttatat 29587309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #184
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 151
Target Start/End: Original strand, 30835109 - 30835161
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc 151  Q
    ||||||| ||||||||||||  |||||||||||||||| ||||||||||||||    
30835109 aacatgatgttttgcaaatacgccctgaagttttgcacatatgtgcaaaatgc 30835161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #185
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 40010128 - 40010076
Alignment:
103 tgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||| || |||||||||||||||||||||||||||| ||||    
40010128 tgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatacccc 40010076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #186
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 40279106 - 40279050
Alignment:
122 cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
40279106 cctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 40279050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #187
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 42802131 - 42802206
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| ||||||| |||||| || || ||||||||||||||||||||||||| ||| | ||||| ||||||||||||    
42802131 aacataacgttttacaaataccctctaaagttttgcacttatgtgcaaaatgtccc-cgaacttaaaaatttatatt 42802206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #188
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 98 - 178
Target Start/End: Complemental strand, 49223652 - 49223572
Alignment:
98 gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||| ||||    |||| |||||||||| |||||||||| |||  |||||||||||||||||||||    
49223652 gaacatgacgttttgcaaatacccccctaaaagtgttgcacttatatgcaaaatgcaccg--aacttgaaaatttatattttt 49223572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #189
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 143
Target Start/End: Original strand, 53757852 - 53757895
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtg 143  Q
    ||||||||||||||||||||||||| |||||||||||||||||||    
53757852 aacatgacgttttgcaaatatcccc-gaagttttgcacttatgtg 53757895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #190
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 54800199 - 54800279
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaac-ttgaaaatttatattttt 178  Q
    ||||| || |||| |||||| |||||||| |||| || |||||||||||||||||| | ||| ||||||||||||||||||    
54800199 aacatcacattttacaaataccccctgaaattttacatttatgtgcaaaatgccccccgaactttgaaaatttatattttt 54800279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #191
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 115 - 174
Target Start/End: Original strand, 17753960 - 17754019
Alignment:
115 aatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||| |||||||| ||||||| ||||||||||||||||||  ||| ||||||||||||||    
17753960 aataccccctgaaattttgcatttatgtgcaaaatgccccctaaatttgaaaatttatat 17754019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #192
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 115 - 174
Target Start/End: Original strand, 19055280 - 19055339
Alignment:
115 aatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||| |||||||| ||||||| ||||||||||||||||||  ||| ||||||||||||||    
19055280 aataccccctgaaattttgcatttatgtgcaaaatgccccctaaatttgaaaatttatat 19055339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #193
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 171
Target Start/End: Original strand, 21414445 - 21414496
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    |||||||| ||||||||||||||||||||||||||  |||||| ||||||||    
21414445 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta 21414496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #194
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 26035022 - 26034964
Alignment:
119 tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||| || |||||||||||||||||| ||||||| |||||||||||||||    
26035022 tcccatgaagttttacatttatgtgcaaaatgcccc-caaacttaaaaatttatattttt 26034964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #195
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 33129274 - 33129200
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| ||||||||||||||  ||||||||||||||| |||||| ||||||| |||  |||||| |||||||||||    
33129274 aacataacgttttgcaaatactccctgaagttttgca-ttatgtacaaaatggccccaaaacttaaaaatttatat 33129200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #196
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 39285329 - 39285274
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
39285329 ctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 39285274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #197
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 198 - 293
Target Start/End: Complemental strand, 40138685 - 40138596
Alignment:
198 acaggtgaggaagttggaactgctgatttcaatttcaattctagtatttgtaatggcggcatgtttctttggtgaattgagctatggaaaaccccc 293  Q
    ||||||||||||||||||||| |||||   ||   |||| ||||||||||||||||| | ||||||||||| |||| ||||||||| ||| |||||    
40138685 acaggtgaggaagttggaactactgat---aa---caatcctagtatttgtaatggctggatgtttctttgctgaaatgagctatgtaaatccccc 40138596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #198
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 54628076 - 54627994
Alignment:
99 aacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgc-cccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||| |||||| |||||  ||||||||| ||||||||||||||||| |||  ||||||| |||||| |||||||    
54628076 aacatgacgttttacaaataccccctctgaagttttgtacttatgtgcaaaatgctccctgaaacttggaaatttttattttt 54627994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #199
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 3022168 - 3022110
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||| |||||||||||||||||||||  |||||| |||||||| ||||||    
3022168 cccctgaaattttacacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 3022110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #200
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 4069940 - 4069998
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
4069940 cccccgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt 4069998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #201
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 13269133 - 13269079
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
13269133 tgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 13269079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #202
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 14898882 - 14898940
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||| |||||||||||||  |||||| |||||||| ||||||    
14898882 cccctgaaattttgcacttatatgcaaaatgccccctaaacttaaaaatttagattttt 14898940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #203
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 22847030 - 22847087
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
22847030 cccctgaaattttgcacttatgtgcaaaatgcccc-taaacttaaaaatttagattttt 22847087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #204
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 27656224 - 27656166
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||| || |||||||| ||||||    
27656224 cccctgaaattttgcacttatgtgcaaaatgccccctaaatttaaaaatttacattttt 27656166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #205
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 29492161 - 29492214
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||||||||||||||| || | |||||||||||||||||||||    
29492161 tgaaattttgcacttatgtgcaaaatgctcc-ctaacttgaaaatttatattttt 29492214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #206
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 33128546 - 33128623
Alignment:
99 aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||| ||||||  || |||||| ||| |||||||||||||||||| |||   |||||||||||||||||    
33128546 aacatgacgttttccaaatacctctcctgaaatttcgcacttatgtgcaaaatgtcccttgaacttgaaaatttatat 33128623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #207
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 33981551 - 33981605
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| |||||||||||||||||||||| |||  |||||||||||| |||||    
33981551 cccctgaaattttgcacttatgtgcaaaatgtcccctaaacttgaaaatatatat 33981605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #208
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 152
Target Start/End: Complemental strand, 37117127 - 37117073
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcc 152  Q
    ||||| ||||||||| ||||||||| | |||||||||||||||||||||||||||    
37117127 aacataacgttttgctaatatccccctaaagttttgcacttatgtgcaaaatgcc 37117073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #209
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40512471 - 40512548
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| ||||||||| |||||| |||| |||||||||||||||||| |||||||||   ||||||| |||| |||||||    
40512471 tgaacttgacgtttttcaaataccccc-gaagttttgcacttatgtacaaaatgcctttcaaacttcaaaaattatatt 40512548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #210
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 45969478 - 45969536
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||| ||||||||||||||||  |||||| |||||||| ||||||    
45969478 cccctgaaattttgcactcatgtgcaaaatgccccctaaacttaaaaatttagattttt 45969536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #211
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 99 - 167
Target Start/End: Original strand, 9665627 - 9665696
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa 167  Q
    ||||||| ||||||||||||  || ||||||||||||||||||||||||||| || | | ||||||||||    
9665627 aacatgatgttttgcaaatacaccgctgaagttttgcacttatgtgcaaaatacctcccgaacttgaaaa 9665696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #212
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 33777658 - 33777722
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| |||||||||||||||| |||||||||  |||||| |||||||| ||||||    
33777658 caaataccccctgaaattttgcacttatgtgc-aaatgccccctaaacttaaaaatttagattttt 33777722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #213
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 129 - 178
Target Start/End: Complemental strand, 45149750 - 45149701
Alignment:
129 ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
45149750 ttttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 45149701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #214
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 8015592 - 8015516
Alignment:
99 aacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||| ||||||||||| | ||||| || ||||||||||||||| |||| ||||||   |||||||||||||||||    
8015592 aacatggcgttttgcaaacacccccttaaagttttgcacttatgtacaaattgccccttgaacttgaaaatttatat 8015516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #215
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 43353690 - 43353750
Alignment:
119 tcccctgaagttttgcacttatgtgcaaaatgccccgcaaa-cttgaaaatttatattttt 178  Q
    ||||||||| ||||||||||||||||||||||||||  |||  || |||||||||||||||    
43353690 tcccctgaaattttgcacttatgtgcaaaatgccccctaaattttaaaaatttatattttt 43353750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #216
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 98 - 150
Target Start/End: Original strand, 49223349 - 49223401
Alignment:
98 gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg 150  Q
    ||||||||||||||| ||||| ||  | |||||||||||||||||||||||||    
49223349 gaacatgacgttttgaaaataccctataaagttttgcacttatgtgcaaaatg 49223401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #217
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 124 - 167
Target Start/End: Original strand, 21576698 - 21576741
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa 167  Q
    |||| ||||||||||||||||||||||||||  |||||||||||    
21576698 tgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaa 21576741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #218
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 107 - 178
Target Start/End: Original strand, 35547103 - 35547174
Alignment:
107 gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||| | |||| |||||||||||  || ||||||||| |||| | || ||||||||||||||||||    
35547103 gttttgcaaacacccccagaagttttgcatctaagtgcaaaataccccccgaatttgaaaatttatattttt 35547174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #219
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 33237732 - 33237674
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||| ||||||||||||||||||||   |||||| |||||||| ||||||    
33237732 cccctgaaattttacacttatgtgcaaaatgccctctaaacttaaaaatttagattttt 33237674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #220
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 37090434 - 37090376
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||||||||||||||||   |||||| ||| |||| ||||||    
37090434 cccctgaaattttgcacttatgtgcaaaatgccctctaaacttaaaattttagattttt 37090376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #221
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 43913831 - 43913889
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||||| |||||||||||  ||| || |||||||| ||||||    
43913831 cccctgaaattttgcacttatgtacaaaatgccccttaaatttaaaaatttagattttt 43913889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #222
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 17754799 - 17754734
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||| ||| |||| |||||||||||||||||||||  ||| || |||||||| ||||||    
17754799 caaataacccccgaattttttcacttatgtgcaaaatgccccctaaatttaaaaatttagattttt 17754734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #223
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 19056119 - 19056054
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||| ||| |||| |||||||||||||||||||||  ||| || |||||||| ||||||    
19056119 caaataacccccgaattttttcacttatgtgcaaaatgccccctaaatttaaaaatttagattttt 19056054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #224
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 153
Target Start/End: Complemental strand, 21414703 - 21414670
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccc 153  Q
    |||||||| |||||||||||||||||||||||||    
21414703 cccctgaaattttgcacttatgtgcaaaatgccc 21414670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #225
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 148
Target Start/End: Complemental strand, 25360291 - 25360242
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaa 148  Q
    |||||||| ||||||||||| ||| | |||| ||||||||||||||||||    
25360291 aacatgactttttgcaaataccccttaaagtattgcacttatgtgcaaaa 25360242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #226
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 139
Target Start/End: Original strand, 36791173 - 36791217
Alignment:
97 tgaacatgacgttttgcaaata--tcccctgaagttttgcactta 139  Q
    ||||||||||||||||||||||   ||||||||||||||||||||    
36791173 tgaacatgacgttttgcaaataccccccctgaagttttgcactta 36791217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #227
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 164
Target Start/End: Original strand, 37089623 - 37089664
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttga 164  Q
    ||||| ||||||||||||||||||||||||||  ||||||||    
37089623 ctgaaattttgcacttatgtgcaaaatgccccttaaacttga 37089664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #228
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 53082076 - 53082121
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt 169  Q
    |||| ||||||||||||||||||||||||||  |||||| ||||||    
53082076 tgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatt 53082121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #229
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 17571759 - 17571817
Alignment:
99 aacatgacgttttgcaaat---atcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||||||||||||||||    ||||  |||||||||||||||||||||||||| ||||    
17571759 aacatgacgttttgcaaaatacatcctatgaagttttgcacttatgtgcaaaatacccc 17571817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #230
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 20411178 - 20411102
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| |||| |||||| | | ||||| ||||| ||||||||||||||||||||   || ||||||||||||||    
20411178 aacatgacattttccaaatacctcactgaaattttgtacttatgtgcaaaatgccccctgaatttgaaaatttatat 20411102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #231
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 124 - 175
Target Start/End: Original strand, 21197095 - 21197144
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||  ||||||||||| || ||||||| ||||||||||||    
21197095 tgaagttttgcactt--gtgcaaaatgcaccccaaacttaaaaatttatatt 21197144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #232
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 142 - 178
Target Start/End: Original strand, 23336197 - 23336233
Alignment:
142 tgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||  ||||||||||||||||||||||    
23336197 tgcaaaatgccccataaacttgaaaatttatattttt 23336233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #233
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 41221820 - 41221896
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||| |||| |||| ||||||| |||||||||| || ||||   ||||| |||||||||||    
41221820 aacatgacattttgcaaatacccccctgaaattttgcatttatgtgcaagataccccctgaacttaaaaatttatat 41221896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #234
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 120 - 164
Target Start/End: Complemental strand, 45970676 - 45970632
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga 164  Q
    |||||||| ||||||||||||||||||||||| ||  ||||||||    
45970676 cccctgaaattttgcacttatgtgcaaaatgcaccctaaacttga 45970632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #235
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 114 - 154
Target Start/End: Complemental strand, 50314360 - 50314320
Alignment:
114 aaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||| |||||||| ||||||||||||||||||||| ||||    
50314360 aaataccccctgaaattttgcacttatgtgcaaaattcccc 50314320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 101; Significance: 9e-50; HSPs: 135)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 101; E-Value: 9e-50
Query Start/End: Original strand, 97 - 221
Target Start/End: Original strand, 3362824 - 3362948
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttgggatgtttgggcatata 196  Q
    |||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
3362824 tgaacatgacgttttgcaaataccccttgaagttttgcacttatatgcaaaatgccccgcaaacttgaaaatttatatttttggtatgtttgggcatata 3362923  T
197 cacaggtgaggaagttggaactgct 221  Q
    || ||||||| ||||||||||||||    
3362924 cagaggtgagaaagttggaactgct 3362948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 26368071 - 26367990
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||    
26368071 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt 26367990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1550115 - 1550193
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
1550115 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 1550193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25774932 - 25775010
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
25774932 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 25775010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 41799943 - 41799863
Alignment:
96 atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
41799943 atgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 41799863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 40651494 - 40651415
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
40651494 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 40651415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 12178671 - 12178593
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||    
12178671 tgaacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttatatt 12178593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 16057406 - 16057483
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
16057406 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 16057483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 28243358 - 28243276
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||||||    
28243358 tgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt 28243276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 44258121 - 44258198
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
44258121 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 44258198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4356835 - 4356915
Alignment:
97 tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
4356835 tgaacatgacgttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 4356915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 15830902 - 15830822
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||  ||||||||||||||||||||||    
15830902 aacatgacgttttgcaaatatccccctgaagttttgtacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 15830822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 35059188 - 35059108
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | |||||||||||||||||||||    
35059188 aacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttatattttt 35059108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 122222 - 122143
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
122222 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 122143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 12178063 - 12178142
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
12178063 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 12178142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 19223607 - 19223528
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
19223607 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 19223528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 22064616 - 22064541
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| | |||||||||||||||||    
22064616 aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat 22064541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 25775531 - 25775452
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
25775531 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 25775452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25991995 - 25992073
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
25991995 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 25992073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 37224590 - 37224669
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
37224590 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 37224669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38964864 - 38964785
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
38964864 tgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 38964785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 39939410 - 39939489
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||  |||||| |||||||||||||||    
39939410 aacatgaagttttgcaaatatcccctgaagttttgcatttatgtgcaaaatgccccctaaacttaaaaatttatattttt 39939489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40598553 - 40598632
Alignment:
97 tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
40598553 tgaacatgacgttttgcaaatatcaccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 40598632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40650885 - 40650964
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
40650885 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 40650964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4357445 - 4357367
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||| || ||||||||||||    
4357445 tgaacatgacgttttgcaaataccccctgaaattttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt 4357367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 32892232 - 32892310
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||    
32892232 tgaagatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaattttatatt 32892310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32892839 - 32892761
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
32892839 tgaacatgaagttttgcaaataccccttgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt 32892761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 39500984 - 39500906
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
39500984 tgaacatgaagttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 39500906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 3434574 - 3434654
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
3434574 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 3434654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 22487267 - 22487347
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
22487267 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 22487347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41799332 - 41799412
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
41799332 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 41799412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 121614 - 121692
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
121614 tgaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 121692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 1550694 - 1550616
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
1550694 aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 1550616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 7532041 - 7532115
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| | |||||||||||||||||    
7532041 aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgcccc-cgaacttgaaaatttatat 7532115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 9708004 - 9708083
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||  |||||||||||||||||||||    
9708004 aacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatttt 9708083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 12138621 - 12138700
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||   ||||||||| ||| |||||||    
12138621 aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaattttttattttt 12138700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 17816189 - 17816114
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| | ||||| |||||||||||    
17816189 aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccgaacttaaaaatttatat 17816114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 22482048 - 22481969
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
22482048 tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 22481969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26367463 - 26367542
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
26367463 tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 26367542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 28242748 - 28242826
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
28242748 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 28242826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 33869760 - 33869839
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |  ||||||||||||    
33869760 tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaattgaaaaatttatatt 33869839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36566451 - 36566372
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
36566451 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 36566372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 2695825 - 2695745
Alignment:
97 tgaacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||| ||||||||| ||  ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
2695825 tgaacatgacgtcttgcaaataccctccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 2695745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 5440230 - 5440307
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
5440230 aacatgacgttttgcgaatactcccttgaagttttgcacttatgtgcaaaatgcccctcaaactttaaaatttatatt 5440307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8345896 - 8345976
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||  |||||| ||||||||||||    
8345896 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt 8345976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 3074951 - 3074872
Alignment:
98 gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
3074951 gaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 3074872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 7275590 - 7275514
Alignment:
99 aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||| ||||||||||| |||||||||||||||||||    
7275590 aacatgacgttttacaaatatctccctaaagttttgcacttatgttcaaaatgccccccaaacttgaaaatttatat 7275514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 21540439 - 21540519
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||| |||| |||||||||||||| ||||||||||| | || ||||||||||||||||||    
21540439 aacatgacgttttgcaaatatccccctgaatttttgcacttatgtacaaaatgccccccgaagttgaaaatttatattttt 21540519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42793755 - 42793675
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||| ||||||| ||||||||||||    
42793755 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttatatt 42793675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 45630054 - 45630134
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |||| ||||||| ||||||||||||    
45630054 tgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttatatt 45630134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 162
Target Start/End: Original strand, 3910330 - 3910393
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaactt 162  Q
    ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||    
3910330 aacataacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccacaaactt 3910393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6166316 - 6166395
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||  |||||| ||||||||||||    
6166316 tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatggccccaaaacttaaaaatttatatt 6166395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8346500 - 8346421
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||  | ||||||| ||||||||||||    
8346500 tgaacatgacgttttgcaaatattctcctgaagttttgcacttatgtgcaaaatgcttcccaaacttaaaaatttatatt 8346421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13700417 - 13700496
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| |||| || ||||||||||||    
13700417 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaatttaaaaatttatatt 13700496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 16058012 - 16057934
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
16058012 tgaacatgacgttt-gcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 16057934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 19222999 - 19223077
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
19222999 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgaccc-caaacttaaaaatttatatt 19223077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 33008457 - 33008379
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| | |||||||||| |||||||    
33008457 tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatg-ccctcgaacttgaaaaattatatt 33008379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 36207107 - 36207186
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||||||| |||||||||||||||| |||||| |||   |||||||||||||||||||||    
36207107 aacatgacgttttgcaaataccccctgatgttttgcacttatgtgtaaaatgtcccatgaacttgaaaatttatattttt 36207186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 107 - 174
Target Start/End: Original strand, 38935863 - 38935930
Alignment:
107 gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||| ||||||| ||||||||||||||||||||||||||||||||||||  |||||||||||||||||    
38935863 gtttagcaaataccccctgaagttttgcacttatgtgcaaaatgccccgtgaacttgaaaatttatat 38935930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42793146 - 42793224
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||| |||||||    
42793146 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaacttatatt 42793224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 108 - 174
Target Start/End: Original strand, 4646038 - 4646104
Alignment:
108 ttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||  ||||||||||||||||||    
4646038 ttttgcaaataccccctgaagttttgcacttatttgcaaaatgccccctaaacttgaaaatttatat 4646104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 28638071 - 28637993
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| | ||| |||||||||||||||||||||||||||||| ||||||| |||||||||||    
28638071 tgaacatgaagttttgcaaatacctccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 28637993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 44747951 - 44747873
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||  | ||||| ||||||||||||    
44747951 tgaacatgacgttttggaaataccccctaaagttttgcacttatgtgcaaaatgcccatcgaacttaaaaatttatatt 44747873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 3435138 - 3435081
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||    
3435138 tgaacatgacgttttgcaaataccccctgaagttttgcacttatatgcaaaatgcccc 3435081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 1091318 - 1091242
Alignment:
99 aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||| || ||||||||||||||||||||||||||||||||| | ||||| |||||||||||    
1091318 aacataacgttttgcaaatacccacctgaagttttgcacttatgtgcaaaatgccccccgaactttaaaatttatat 1091242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 3106284 - 3106364
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| |||||||||||| ||||  ||||||||||||||||||||||||||||||   |||||||||||||||||||||    
3106284 aacatgatgttttgcaaatacccccaagaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatattttt 3106364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 3107030 - 3106954
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||   ||||| |||||||||||    
3107030 aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccatgaacttaaaaatttatat 3106954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 4647012 - 4646932
Alignment:
99 aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||| ||||   || ||||||||||||||||||    
4647012 aacatgacgttttgcaaatatcttcctgaagttttgcacttatgtgcaaaatcccccctgaatttgaaaatttatattttt 4646932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 5606926 - 5607006
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||| | | |||||||||||||||||||||||||||||||| | ||||| |||||||||||||||    
5606926 aacatgacattttgcaaatacctcactgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatattttt 5607006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 9708932 - 9708852
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||   ||||| |||||||||||||||    
9708932 aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccccctgaactttaaaatttatattttt 9708852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 14251994 - 14252074
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| | || |||||||||||||||||||||||||| |||| | ||||| |||||||||||||||    
14251994 aacatgacgttttgcaaatacctccatgaagttttgcacttatgtgcaaaataccccccgaacttaaaaatttatattttt 14252074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 20207163 - 20207243
Alignment:
99 aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| ||||||||||||||| | |||||||||||||||||| |||||||||| ||| ||||||| |||||||||||||||    
20207163 aacatcacgttttgcaaatattctcctgaagttttgcacttacgtgcaaaatgtccctcaaacttaaaaatttatattttt 20207243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 22064036 - 22064115
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| ||||  |||||||||||||||||||||||||||||||  |||||| |||||||||||    
22064036 tgaacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatat 22064115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6166924 - 6166846
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| | ||| ||| ||||||||||||    
6166924 tgaacatgacgttttgcaaatactcccctgaagttttgcatttatgtgcaaaatgcctc-caagcttaaaaatttatatt 6166846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7778482 - 7778403
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||   |||| || ||||||||||||    
7778482 tgaacatgacgttttgcaaatatccccctgaaattttgcacttatgtgcaaaatgccatccaaatttaaaaatttatatt 7778403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 21545326 - 21545247
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| || ||||||||||| ||||||||||||||||||||||||||||||||| |   ||||||||||||||| |||||    
21545326 aacataacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgcctcctgaacttgaaaatttatgttttt 21545247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 37225192 - 37225111
Alignment:
98 gaacatgacgttttgcaaata---tcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||   ||||| ||||||||||||||||||||||||||||||| ||||||| |||| |||||||    
37225192 gaacatgacgttttgcaaatactttccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaacttatatt 37225111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 3074380 - 3074438
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||    
3074380 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc 3074438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 7777595 - 7777673
Alignment:
98 gaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||| | ||||||||||||| |||||||||||||||  ||| ||||||| ||||||||||||    
7777595 gaacatgacgttttgcaaatacctccctgaagttttgtacttatgtgcaaaatatcccccaaacttaaaaatttatatt 7777673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 17815597 - 17815674
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| |||| ||| ||||||||||||||||||||||||||| ||||||| |||||||||||    
17815597 tgaacatgaagttttgcaaatacccccctgatgttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatat 17815674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 102 - 178
Target Start/End: Original strand, 35058321 - 35058397
Alignment:
102 atgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||| ||||||||||| |||| |||||||||||||||||||||||||| | |||||||||||||||| ||||    
35058321 atgacgttttacaaatatccccctgaaattttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttataatttt 35058397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 102 - 178
Target Start/End: Original strand, 41425552 - 41425629
Alignment:
102 atgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||| |||| |||||||||||||||||||||||||| ||||   |||||||||||||||| ||||    
41425552 atgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaataccccatgaacttgaaaatttataatttt 41425629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 7338811 - 7338735
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| || ||||||||||| ||||  |||||||||||||||||||||||||||||  |||||||||||||||||||    
7338811 aacataactttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgccctccaaacttgaaaatttatat 7338735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 34926022 - 34925942
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||| |||||||||| | ||||||||||||||||||  ||||||||||||| || |||||    
34926022 aacatgacgttttgcaaatacccccctgaagttttgtagttatgtgcaaaatgccccctaaacttgaaaattcattttttt 34925942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 33437960 - 33437882
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| ||||| |||| |||||||||||||||||||||||||||||||  || ||| ||||||||||||    
33437960 tgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-aaatcttaaaaatttatatt 33437882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 7277908 - 7277985
Alignment:
99 aacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||  ||||||||||||||||||||||||| |||| ||||    ||||||||||||||||    
7277908 aacatgacgttttgcaaatattccccctgaagttttgcacttatgtgcgaaattccccctggacttgaaaatttatat 7277985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 10575036 - 10574978
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||| ||  ||||||||||||||||||||||    
10575036 cccctgaaattttgcacttatgtgcaaaatgcaccctaaacttgaaaatttatattttt 10574978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 11871351 - 11871270
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||| ||||| |||||| ||||| |||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||    
11871351 tgaacatgaagttttacaaatacccccttgaagttttgcgcttatgtgcaaaatgtccc-caaacttaaaaatttatattttt 11871270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 17540330 - 17540264
Alignment:
113 caaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||| |||||| ||||||||||||||||||||||||||  |||||| |||||||||||||||    
17540330 caaatatcctcctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt 17540264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 23849083 - 23849160
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| ||||  |||||||||||| |||||||||||||| ||| | |||||||||||||||||    
23849083 aacatgatgttttgcaaataccccccctgaagttttgcaattatgtgcaaaatgtcccccgaacttgaaaatttatat 23849160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 27482231 - 27482173
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||| ||||||||||||||||||||  ||||||||||||||||||||||    
27482231 cccctgaaattttgtacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 27482173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 41727055 - 41726997
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||||||||||||||||   ||||||||||||||||||||||    
41727055 cccctgaaattttgcacttatgtgcaaaatgccctctaaacttgaaaatttatattttt 41726997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 45159740 - 45159798
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||||||||||    
45159740 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt 45159798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 29365948 - 29366013
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||| ||||||||||||||||||  |||||| |||||||||||||||    
29365948 caaataccccctgaaattttgcagttatgtgcaaaatgccccctaaacttaaaaatttatattttt 29366013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 105 - 174
Target Start/End: Complemental strand, 36208005 - 36207936
Alignment:
105 acgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||| |    |||||||||||||||||    
36208005 acgttttgcaaataccccctaaagttttgcacttatgtgcaaaatgctctctgaacttgaaaatttatat 36207936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 8307414 - 8307338
Alignment:
99 aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||||| ||||| || |||| ||||||| ||||||||| ||| | |||||||||||||||||    
8307414 aacatgacgttttgcaaatattcccctaaaattttacacttatatgcaaaatgtcccccgaacttgaaaatttatat 8307338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 20463650 - 20463574
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||| ||||||||||||||| |||| ||||||||| |||||||||||||||||| ||   |||||||||||||||||    
20463650 aacacgacgttttgcaaatactcccttgaagttttacacttatgtgcaaaatgctccttgaacttgaaaatttatat 20463574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 7532618 - 7532540
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaa-tgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| ||||| |||||||||||||||||||||||| |||||| ||| ||| |||||||||||    
7532618 tgaacatgaagttttgcaaatacccccttgaagttttgcacttatgtgcaaaaatgccccccaa-cttaaaaatttatat 7532540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 113 - 176
Target Start/End: Complemental strand, 45160296 - 45160233
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||| |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||    
45160296 caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattt 45160233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 5438993 - 5438935
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
5438993 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 5438935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 6082249 - 6082191
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||| ||||||||||||||  ||| ||||||||||||||||||    
6082249 cccctgaaattttgcacttaagtgcaaaatgccccctaaaattgaaaatttatattttt 6082191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 18060463 - 18060409
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| |||||||||||||||||||||| |||  ||||||||||||||||||    
18060463 cccctgaaattttgcacttatgtgcaaaatgtcccctaaacttgaaaatttatat 18060409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 28150844 - 28150786
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
28150844 cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt 28150786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 166
Target Start/End: Original strand, 28636238 - 28636307
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaa 166  Q
    |||||||||||||||||||| ||||  ||||||||| |||||||||||||||| |||| | |||||||||    
28636238 aacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaattccccccgaacttgaaa 28636307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 41287267 - 41287209
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
41287267 cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt 41287209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 43208992 - 43208934
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
43208992 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 43208934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #107
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 7337915 - 7337988
Alignment:
102 atgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||   |||||||||||||||||| |||||||||| |||   |||||||||||||||||    
7337915 atgacgttttgcaaatattttcctgaagttttgcacttaagtgcaaaatgacccttgaacttgaaaatttatat 7337988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 12139321 - 12139245
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||| |||| || ||||||||||||||||||||||||| |  | ||||| |||||||||||    
12139321 aacataacgttttgcaaatacccccctgcagttttgcacttatgtgcaaaatgctctccgaactttaaaatttatat 12139245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 39500402 - 39500478
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||| ||||| || || |||||||| ||||||||||||||||  ||| | |||||||||||||||||    
39500402 aacatgacgttttgtaaataccctcttgaagttttacacttatgtgcaaaatatcccccgaacttgaaaatttatat 39500478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 43207005 - 43207061
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||||| ||||||| |||||||||||||| |||  ||||||||||||||||||||    
43207005 cccctgaaattttgcatttatgtgcaaaatgtcccctaaacttgaaaatttatattt 43207061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #111
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 5607512 - 5607437
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||| |||||||||||| |||||||  ||||| | |   |||||||||||||||||    
5607512 aacatgacgttttgcaaataccccatgaagttttgcagttatgtgggaaatgtcacctgaacttgaaaatttatat 5607437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #112
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 20207765 - 20207687
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| |||||||  ||||| ||||| || ||||||||||||||||||||| ||||   |||||||||||||||||||||    
20207765 aacatcacgttttaaaaataccccctaaaattttgcacttatgtgcaaaatacccc-tgaacttgaaaatttatattttt 20207687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #113
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 28150021 - 28150080
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaac-ttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||| || |||||||||||||||    
28150021 cccctgaaattttgcacttatgtgcaaaatgccccctaaactttaaaaatttatattttt 28150080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #114
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 175
Target Start/End: Original strand, 28586967 - 28587022
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||| |||||||||||||||| ||||||||   |||||||||||||||||||    
28586967 cccctgaaattttgcacttatgtgccaaatgccctctaaacttgaaaatttatatt 28587022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #115
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 38939222 - 38939147
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||  ||||||| ||||||| ||||||||||||||||||| ||||||||| |  ||| || |||||||||||    
38939222 aacatgaaattttgcagatatcccttgaagttttgcacttatgttcaaaatgccgcctaaatttaaaaatttatat 38939147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 3364018 - 3363936
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||| |||||||| ||| |||| |||| ||||||||| |||||||||||||||  ||||  | |||||||||||||||    
3364018 tgaacatgaagttttgcacatacccccctgaaattttgcactaatgtgcaaaatgcccttcaaatataaaaatttatattttt 3363936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #117
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 152
Target Start/End: Complemental strand, 9759087 - 9759038
Alignment:
102 atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcc 152  Q
    |||| |||||| ||||| |||||||||||||||||||||||||||||||||    
9759087 atgatgttttgtaaata-cccctgaagttttgcacttatgtgcaaaatgcc 9759038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #118
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 11865515 - 11865591
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| ||||| || ||||||||||||||| |||||||||| | ||||| | ||||||||||    
11865515 tgaacatgaagttttgcaaata-cccctcaaattttgcacttatgtgaaaaatgcccc-cgaacttaataatttatatt 11865591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #119
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 18059635 - 18059693
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||| ||||||||||||||||||||  |||||| |||||||| ||||||    
18059635 cccctgaaattttgtacttatgtgcaaaatgccccataaacttaaaaatttaaattttt 18059693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #120
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 29366499 - 29366441
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| || ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
29366499 cccctaaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 29366441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #121
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 2695006 - 2695075
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| |||||||||||        ||||||||||||||| ||||||| ||||||||||||    
2695006 tgaacatgacgttttgcaaatat-ccctgaagttt--------tgtgcaaaatgccccccaaacttaaaaatttatatt 2695075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #122
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 129 - 178
Target Start/End: Original strand, 6081120 - 6081169
Alignment:
129 ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
6081120 ttttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 6081169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #123
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 99 - 151
Target Start/End: Original strand, 9758419 - 9758472
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgc 151  Q
    ||||| |||| |||||||||||||| |||| |||||||||||||||||||||||    
9758419 aacatcacgtattgcaaatatccccctgaatttttgcacttatgtgcaaaatgc 9758472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #124
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 134 - 175
Target Start/End: Complemental strand, 44258689 - 44258648
Alignment:
134 cacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||| ||||||| ||||||||||||    
44258689 cacttatgtgcaaaatgccccccaaacttaaaaatttatatt 44258648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #125
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 96 - 172
Target Start/End: Original strand, 44747081 - 44747157
Alignment:
96 atgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    |||||||||||||||| |||||| ||| || ||||||||||||||| ||||||||| ||| | |||||||| ||||||    
44747081 atgaacatgacgttttacaaatacccctctaaagttttgcacttatatgcaaaatgtccc-cgaacttgaatatttat 44747157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #126
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 33437341 - 33437381
Alignment:
96 atgaacatgacgttttgcaaatatcccctgaagttttgcac 136  Q
    ||||||||||| ||||||||||| |||||||||||||||||    
33437341 atgaacatgacattttgcaaataccccctgaagttttgcac 33437381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 159
Target Start/End: Original strand, 28636578 - 28636617
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaa 159  Q
    |||||||| |||||||||||||||||||||||||| ||||    
28636578 cccctgaaattttgcacttatgtgcaaaatgccccccaaa 28636617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 41286436 - 41286495
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttg-aaaatttatattttt 178  Q
    ||||| || |||||||||||||||||||| |||||  ||||||| |||||||||||||||    
41286436 cccctaaaattttgcacttatgtgcaaaacgccccctaaacttgaaaaatttatattttt 41286495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #129
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 27481412 - 27481470
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||  ||||||||||||  |||||| |||||||| ||||||    
27481412 cccctgaaattttgcacttatacgcaaaatgccccataaacttaaaaatttagattttt 27481470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #130
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 28587525 - 28587467
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||| ||||||||||||||||  ||||||  ||||||| ||||||    
28587525 cccctgaaattttgcactaatgtgcaaaatgccccctaaactttcaaatttagattttt 28587467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #131
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 130 - 175
Target Start/End: Original strand, 33437385 - 33437431
Alignment:
130 tttgcacttatgtgcaaaatgccccgcaaactt-gaaaatttatatt 175  Q
    ||||||||||||||||||||||||| |||||||  ||||||||||||    
33437385 tttgcacttatgtgcaaaatgccccccaaacttaaaaaatttatatt 33437431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 7278260 - 7278207
Alignment:
99 aacatgacgttttg-caaatatc-ccctgaagttttgcacttatgtgcaaaatg 150  Q
    |||||||||||||  |||||||| ||||||||||||| ||||||||||||||||    
7278260 aacatgacgttttttcaaatatcaccctgaagttttggacttatgtgcaaaatg 7278207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 147
Target Start/End: Complemental strand, 36208084 - 36208035
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaa 147  Q
    ||||| |||||||||||||  |||| ||||||||||||||||||||||||    
36208084 aacattacgttttgcaaatgcccccctgaagttttgcacttatgtgcaaa 36208035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #134
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 126 - 154
Target Start/End: Original strand, 1090669 - 1090697
Alignment:
126 aagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||||||||||||    
1090669 aagttttgcacttatgtgcaaaatgcccc 1090697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #135
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 139
Target Start/End: Complemental strand, 28780339 - 28780300
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcactta 139  Q
    ||||| |||||||||||||| ||||||||||||||||||||    
28780339 aacataacgttttgcaaata-cccctgaagttttgcactta 28780300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 74; Significance: 1e-33; HSPs: 204)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 40246073 - 40245992
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||    
40246073 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt 40245992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30838548 - 30838626
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
30838548 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 30838626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39628509 - 39628587
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
39628509 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 39628587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39628928 - 39628850
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
39628928 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 39628850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 44335281 - 44335359
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
44335281 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 44335359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 21176095 - 21176176
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||    
21176095 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgtaaaatgccccccaaacttaaaaatttatattttt 21176176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 100 - 175
Target Start/End: Original strand, 3628074 - 3628149
Alignment:
100 acatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
3628074 acatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 3628149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 35500576 - 35500497
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
35500576 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 35500497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36644167 - 36644246
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
36644167 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 36644246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43774659 - 43774738
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
43774659 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 43774738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37231395 - 37231317
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
37231395 tgaacatgacgttttgcaaacatcccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 37231317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41081004 - 41080926
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
41081004 tgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 41080926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 46230191 - 46230114
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
46230191 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 46230114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 10463948 - 10463869
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||| ||||||||    
10463948 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaagtttatatt 10463869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17271917 - 17271996
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
17271917 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 17271996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 21459466 - 21459388
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||  ||| ||||||||||||||||||    
21459466 aacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgccccataaatttgaaaatttatattttt 21459388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26303418 - 26303497
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
26303418 tgaacatgacgttttgcaaatatccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 26303497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 28290142 - 28290221
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
28290142 tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 28290221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40668059 - 40668138
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
40668059 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 40668138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 44335889 - 44335810
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
44335889 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 44335810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 44744393 - 44744472
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
44744393 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 44744472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 46100869 - 46100790
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
46100869 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 46100790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 46949634 - 46949560
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||||    
46949634 aacatgacgttttgcaaatacccccggaagttttgcacttatgtgcaaaatgcccc-caaacttgaaaatttatat 46949560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21176700 - 21176622
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
21176700 tgaacatgacgttttacaaataccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 21176622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 35004324 - 35004401
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||    
35004324 tgaacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaattccccccaaacttaaaaatttatatt 35004401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 35788290 - 35788367
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||    
35788290 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatacccc-caaacttaaaaatttatatt 35788367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39403522 - 39403445
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
39403522 tgaacatgacgttttgcaaataccccc-gaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 39403445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42029194 - 42029117
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||    
42029194 tgaacatgacgttttgcaaataccccctgaagttt-gcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 42029117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43670725 - 43670802
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
43670725 tgaacatgacattttgcaaata-cccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 43670802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 43775524 - 43775447
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
43775524 tgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 43775447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 44388376 - 44388294
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||    
44388376 tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt 44388294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7337897 - 7337817
Alignment:
97 tgaacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||  ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
7337897 tgaacatgacgttttgcaaatacccaccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 7337817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 34994655 - 34994575
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
34994655 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 34994575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 44745001 - 44744924
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
44745001 aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 44744924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 45155044 - 45155124
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
45155044 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 45155124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 45155655 - 45155575
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
45155655 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 45155575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 97 - 176
Target Start/End: Original strand, 18928218 - 18928298
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||||  ||||||||||||    
18928218 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttttaaatttatattt 18928298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6804891 - 6804812
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| ||||||| ||||||||||||    
6804891 tgaacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt 6804812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8641033 - 8641112
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
8641033 tgaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt 8641112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8641641 - 8641563
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
8641641 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 8641563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 17272526 - 17272447
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
17272526 tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 17272447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 18121424 - 18121346
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
18121424 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 18121346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 21458743 - 21458822
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||||||| || |||||||||||||| |||||||||||  ||| ||||||||||||||||||    
21458743 aacatgacgttttgcaaatatcccctaaaattttgcacttatgtacaaaatgccccttaaatttgaaaatttatattttt 21458822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 34962508 - 34962586
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
34962508 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 34962586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 34963111 - 34963032
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || ||||||||||||    
34963111 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt 34963032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 34993776 - 34993855
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
34993776 tgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 34993855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36787381 - 36787302
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| | |||||||||||||||| |||||||||||| ||||||| ||||||||||||    
36787381 tgaacatgacgttttgcaaatatccccctaaagttttgcacttatgcgcaaaatgccccccaaacttaaaaatttatatt 36787302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37007801 - 37007722
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || ||||||||||||    
37007801 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt 37007722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38171638 - 38171559
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||| | ||||||||||||    
38171638 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt 38171559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38354105 - 38354184
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
38354105 tgaacatgacgttttgcaaatacccacctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 38354184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 101 - 175
Target Start/End: Complemental strand, 38354710 - 38354635
Alignment:
101 catgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
38354710 catgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 38354635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43082389 - 43082467
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
43082389 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgtccc-caaacttaaaaatttatatt 43082467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 47170932 - 47170853
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
47170932 tgaacatgacgtttcgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 47170853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 18031691 - 18031613
Alignment:
98 gaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
18031691 gaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 18031613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36786774 - 36786851
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||| ||||||||||||||| |||| ||||||| ||||||||||||    
36786774 tgaacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatacccc-caaacttaaaaatttatatt 36786851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39402917 - 39402994
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| || | ||||| ||||||||||||    
39402917 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgctcc-ccaacttaaaaatttatatt 39402994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 44781930 - 44781852
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| || |||||||||||||||||||||||||||| |||| ||||||| |||||||||||    
44781930 tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaattcccctcaaacttaaaaatttatat 44781852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7462921 - 7462841
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
7462921 tgaacatgatgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 7462841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38171035 - 38171115
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| ||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
38171035 tgaagatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 38171115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 23678840 - 23678760
Alignment:
99 aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| ||||||| |||||| | |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||    
23678840 aacatcacgttttacaaatacctccctgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttatattttt 23678760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 40245197 - 40245273
Alignment:
98 gaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata 173  Q
    |||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||| ||||||| ||||||||||    
40245197 gaacatgacgttttgcaaatatcctcctgaagttttacacttatgtgcaaaatgtcccccaaacttaaaaatttata 40245273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 104 - 175
Target Start/End: Complemental strand, 43671602 - 43671530
Alignment:
104 gacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
43671602 gacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccacccaaacttaaaaatttatatt 43671530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7337298 - 7337377
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
7337298 tgaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 7337377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 14102952 - 14103031
Alignment:
99 aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||  ||| |||||||||||||||||    
14102952 aacataacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgccccctaaatttgaaaatttatatttt 14103031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 14412969 - 14413048
Alignment:
99 aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||  ||| |||||||||||||||||    
14412969 aacataacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgccccctaaatttgaaaatttatatttt 14413048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17897166 - 17897245
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||  |||||||||||||||||||||||||||||||| ||| ||| ||||||||||||    
17897166 tgaacatgacgttttgcaaatacccttctgaagttttgcacttatgtgcaaaatgccccccaagcttaaaaatttatatt 17897245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 18031081 - 18031160
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| | |||||||||| |||||||||||||||||| ||||||| ||||||||||||    
18031081 tgaacatgacgttttgcaaatacccccctaaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttatatt 18031160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 19488716 - 19488794
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
19488716 tgaacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 19488794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 102 - 178
Target Start/End: Complemental strand, 24213339 - 24213261
Alignment:
102 atgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||  |||||| || ||||||||||||||||||||||||||  ||||||||||||||||||||||    
24213339 atgacgttttgcaaatacctcccctcaaattttgcacttatgtgcaaaatgccccttaaacttgaaaatttatattttt 24213261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 26928208 - 26928283
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| |||||||||||||| ||||||||||||||||||||   |||||||||||||||||    
26928208 aacatgatgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttatat 26928283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41409007 - 41409086
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||  |||| |||||||    
41409007 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaactaaaaaaattatatt 41409086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 46100260 - 46100339
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
46100260 tgaacattacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 46100339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 11455553 - 11455630
Alignment:
98 gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata 173  Q
    ||||||||| ||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||    
11455553 gaacatgacattttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttata 11455630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 29418099 - 29418018
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||| ||||  |||||||||||||||||||||||||||||||   |||||||||||||||||||||    
29418099 aacatgacattttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatattttt 29418018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 35004928 - 35004852
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||    
35004928 tgaacatgacattttgcaaata-cccctgaagttttgcacttatgtgcaaaattcccc-caaacttaaaaatttatatt 35004852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 36709397 - 36709455
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
36709397 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgcccc 36709455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6804010 - 6804090
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| ||||||||| ||   ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
6804010 tgaacatgatgttttgcaagtactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 6804090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 101 - 178
Target Start/End: Complemental strand, 8124939 - 8124862
Alignment:
101 catgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||| |||||||| |||||||||||| | |||||||  || |||||||||||||||||||||||    
8124939 catgacgttttgcaaataccccctgaaattttgcacttatatacaaaatgttcctcaaacttgaaaatttatattttt 8124862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24182620 - 24182540
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| |||| |||||||    
24182620 tgaacataacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaaattatatt 24182540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 162
Target Start/End: Original strand, 26342731 - 26342796
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaactt 162  Q
    |||||||||||||||||||||| || |||||||||||||||||||||||||||||||  |||||||    
26342731 tgaacatgacgttttgcaaataccctctgaagttttgcacttatgtgcaaaatgccctccaaactt 26342796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 99 - 173
Target Start/End: Original strand, 30162546 - 30162622
Alignment:
99 aacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata 173  Q
    |||||||||||||||||| ||||  ||||||||||| ||||||||||||||||||||| ||||||| ||||||||||    
30162546 aacatgacgttttgcaaacatcctccctgaagtttttcacttatgtgcaaaatgccccccaaacttaaaaatttata 30162622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 34345372 - 34345437
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
34345372 caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 34345437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41409557 - 41409477
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||| ||||||||||||||||||||| ||||| | ||||||||||||    
41409557 tgaacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccaaacataaaaatttatatt 41409477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 173
Target Start/End: Complemental strand, 41642223 - 41642146
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata 173  Q
    ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||  ||| || ||||||||||    
41642223 tgaacataacgttttgcaaatatccctctgaagttttgcacttatgtgcaaaatgcccccaaaatttaaaaatttata 41642146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 43759622 - 43759702
Alignment:
99 aacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| ||||||| |||||| |||||  ||||||||||||||||||||||||||||||  |||||||||||||||||||||    
43759622 aacataacgttttccaaataccccctctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatttt 43759702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 99 - 152
Target Start/End: Complemental strand, 44950682 - 44950629
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcc 152  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
44950682 aacatgacgttttgcaaatatcccctgaagttttgcagttatgtgcaaaatgcc 44950629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 48936291 - 48936368
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||| | ||||| ||||||||||||    
48936291 aacatgacgttttgcagatacccccatgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatatt 48936368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 22114003 - 22114086
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| ||| ||||||||||| ||||  ||||||||| ||||||||||||||||||||| | |||||||||||||||||||||    
22114003 tgaacacgacattttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatattttt 22114086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 24212441 - 24212517
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||  | ||| |||||||||||||    
24212441 aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccctccgaacatgaaaatttatat 24212517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 26831664 - 26831740
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||   |||||||||||||||||    
26831664 aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccccatgaacttgaaaatttatat 26831740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 29417259 - 29417339
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||| |||||||||||| ||||||||||||||||||  ||||||||||||| || |||||    
29417259 aacatgacgttttgcaaatacccccctgaagttttgcagttatgtgcaaaatgccccctaaacttgaaaattcattttttt 29417339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 33697307 - 33697231
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| |||||||||||    
33697307 aacatgatgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatat 33697231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 40525438 - 40525355
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| ||| ||||||||||| ||||  ||||||||| ||||||||||||||||||||| | |||||||||||||||||||||    
40525438 tgaacacgacattttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatattttt 40525355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 107 - 178
Target Start/End: Complemental strand, 4288310 - 4288239
Alignment:
107 gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||| |||||||||||||| |||||||||||||||||| | | || ||||||||||||||||||    
4288310 gttttgcaaataccccctgaagttttgtacttatgtgcaaaatgcctcccgaaattgaaaatttatattttt 4288239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 5211197 - 5211119
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||  |||| |||||| |||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||    
5211197 aacatgatattttacaaataccccctgaagttttgcacttatgtgcaaaatgctcc-caaacttaaaaatttatattttt 5211119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 18829198 - 18829273
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||| ||| ||||||||||||||||||||||||||||| | | ||||||||||| |||||    
18829198 aacatcacgttttgcaaataccccttgaagttttgcacttatgtgcaaaatgcctcccgaacttgaaaatatatat 18829273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 23379137 - 23379059
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||  |||||| ||| ||||||||    
23379137 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-aaaacttaaaattttatatt 23379059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24182009 - 24182088
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  |||||||||||||||||||| ||||||||| ||||||| |||| |||||||    
24182009 tgaacatgacgttttgcaaatacccccccgaagttttgcacttatgtgccaaatgccccccaaacttaaaaaattatatt 24182088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24466434 - 24466513
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaa-atgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| |||||||||||||||||||||||| ||  ||| ||||||| ||||||||||||    
24466434 tgaacatgacgttttgcaaataccccttgaagttttgcacttatgtgcaaatataacccccaaacttaaaaatttatatt 24466513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 26832587 - 26832508
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgc-aaacttgaaaatttatatttt 177  Q
    ||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||| | ||| | |||||||||||||||    
26832587 aacataacgtttggcaaataccccctgaagttttgcacttatgtgcaaaatgcccccctaaattggaaaatttatatttt 26832508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30890346 - 30890425
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| ||||||| ||||||||||||||||| |||  ||||||| ||||||||||||    
30890346 tgaacatgacgttttgcaaataccccctcaagttttacacttatgtgcaaaatgtccctccaaacttaaaaatttatatt 30890425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 107 - 174
Target Start/End: Complemental strand, 31309357 - 31309290
Alignment:
107 gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||||| | ||||| |||||||||||    
31309357 gttttgcaaataccccttgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatat 31309290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 34959118 - 34959043
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||| ||||||||||||| ||||||||||||||||| |||   |||||||||||||||||    
34959118 aacattacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgtcccctgaacttgaaaatttatat 34959043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 36897527 - 36897602
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||||||||||||| | |||||||||||||||| |   |||||||||||||||||    
36897527 aacatgacgttttgcaaataccccctgaagttttgtatttatgtgcaaaatgcctccttaacttgaaaatttatat 36897602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 38184330 - 38184389
Alignment:
119 tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
38184330 tcccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 38184389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 164
Target Start/End: Original strand, 40524715 - 40524782
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga 164  Q
    |||||||||| ||||||||||| ||||||||||||||||||| ||||||||||| ||| |||||||||    
40524715 tgaacatgacattttgcaaataccccctgaagttttgcacttgtgtgcaaaatgtcccccaaacttga 40524782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 108 - 175
Target Start/End: Complemental strand, 40668655 - 40668589
Alignment:
108 ttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||  ||||||| ||||||||||||    
40668655 ttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt 40668589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41080397 - 41080475
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| | |||||||||| |||||||||||||||||| ||||||| ||||||||||||    
41080397 tgaacatgacgttttgcaaatacccccctaaagttttgca-ttatgtgcaaaatgccccccaaacttaaaaatttatatt 41080475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42028586 - 42028665
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||| ||||||||| |||| |||||||||||||||||||| |||||||||| ||||||| ||| ||||||||    
42028586 tgaacatgacgtattgcaaatacccccctgaagttttgcacttatgtgtaaaatgccccccaaacttaaaattttatatt 42028665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 48611251 - 48611196
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||    
48611251 aacatgacgttttgcaaataccccccgaagttttgcacttatgtgcaaaatgcccc 48611196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 48937167 - 48937089
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||  |||||| ||||||||||||    
48937167 tgaacatgtcgttttgcaaatatcctcttgaagttttgcacttatgtgcaaaatgcccc-aaaacttaaaaatttatatt 48937089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 105 - 174
Target Start/End: Original strand, 4287071 - 4287141
Alignment:
105 acgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||| |||| ||||||||||||||||||||| ||||||||| | |||||||||||||||||    
4287071 acgttttgcaaatacccccctgaagttttgcacttatgtgctaaatgccccccgaacttgaaaatttatat 4287141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 7462035 - 7462110
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||| ||||||| || |||||||||||||||  ||||||||||||||| ||||||| |||||||||||    
7462035 tgaacatgacgtttcgcaaataccctctgaagttttgcact--tgtgcaaaatgcccctcaaacttcaaaatttatat 7462110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 105 - 178
Target Start/End: Original strand, 31308379 - 31308452
Alignment:
105 acgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||| || |||||||||||||||||||||||||||||||||   |||||||||||||||||||||    
31308379 acgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgcccc-tgaacttgaaaatttatattttt 31308452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 36900726 - 36900645
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtg--caaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| |||| ||||||||||||||||||||  |||||||||||  |||||||||||||||||||||    
36900726 aacataacgttttgcaaatacccccctgaagttttgcacttatgtgtgcaaaatgccccctaaacttgaaaatttatatttt 36900645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 45259614 - 45259537
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||  ||||||||| ||||||||||||||||||||| | ||||| |||||||||||    
45259614 aacatgacgttttgcaaataccccccctgaagttttacacttatgtgcaaaatgccccccgaacttcaaaatttatat 45259537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 48610762 - 48610839
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||  ||||||||||||||||||||||||||||  | | |||||||||||||||||    
48610762 aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcaacccgaacttgaaaatttatat 48610839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 3628679 - 3628599
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| ||||||||||||| || ||||  |||||||||||||||||||||||||||||||  |||||| ||||||||||||    
3628679 tgaacgtgacgttttgcaagtaccccccctgaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttatatt 3628599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 19072129 - 19072072
Alignment:
121 ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
19072129 ccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 19072072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 48343718 - 48343783
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| ||| |||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
48343718 caaataccccttgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 48343783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 104 - 175
Target Start/End: Complemental strand, 1730209 - 1730137
Alignment:
104 gacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||| ||||||| ||||||||||||||||||||||||||||||||| | ||||||| ||||| ||||||    
1730209 gacgttttacaaatattcccctgaagttttgcacttatgtgcaaaatgcctctcaaacttaaaaatatatatt 1730137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 175
Target Start/End: Complemental strand, 24646847 - 24646779
Alignment:
108 ttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||| |||| |||||||||||||||||||||||||| |||| ||||||| ||||||||||||    
24646847 ttttgcaaatacccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaatttatatt 24646779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #123
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 30023217 - 30023141
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| |||| ||||||||||||||||||||||||||| ||  ||||||| |||||||||||    
30023217 aacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcctccaaacttaaaaatttatat 30023141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #124
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 170
Target Start/End: Complemental strand, 35499312 - 35499240
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    |||||||||||||||||||| |||| ||||||||| ||||||| ||||||||||||| | |||||||||||||    
35499312 aacatgacgttttgcaaatacccccctgaagttttacacttatttgcaaaatgccccccgaacttgaaaattt 35499240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #125
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 40341170 - 40341111
Alignment:
97 tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||    
40341170 tgaacatgacgttttgcaaatacctcccctgaagttttgcacttatgtgcaaagtgcccc 40341111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #126
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 44378927 - 44379005
Alignment:
99 aacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||||||   ||||||||| ||||||||||||||||| ||| | |||||||| ||||||||    
44378927 aacatgacgttttgcaaatatccccccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaagatttatat 44379005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #127
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 44387794 - 44387872
Alignment:
99 aacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||||||   ||||||||| ||||||||||||||||| ||| | |||||||| ||||||||    
44387794 aacatgacgttttgcaaatatccccccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaagatttatat 44387872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #128
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 2755989 - 2755910
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| | |||| |||| |||||||||||||||||||||||||||||||   ||||| ||||||||||||    
2755989 tgaacatgacgttttacgaatactcccatgaagttttgcacttatgtgcaaaatgccccatgaacttaaaaatttatatt 2755910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #129
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 17774427 - 17774501
Alignment:
102 atgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||| ||||  |||||||||||||||||||||||||||||||   || ||||||||||||||    
17774427 atgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctgaaattgaaaatttatat 17774501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #130
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 107 - 174
Target Start/End: Original strand, 21124956 - 21125023
Alignment:
107 gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||| |||||||| |||||||||||| ||||||||||||| | ||||| |||||||||||    
21124956 gttttgcaaataccccctgaaattttgcacttatctgcaaaatgccccccgaactttaaaatttatat 21125023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #131
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 21366403 - 21366458
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
21366403 ctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 21366458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #132
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 107 - 174
Target Start/End: Original strand, 33227811 - 33227878
Alignment:
107 gttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||| ||||||||||||||||||||||||||||||||||    |||||||||||||||||    
33227811 gttttacaaataccccctgaagttttgcacttatgtgcaaaatgcccgttgaacttgaaaatttatat 33227878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #133
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 37007190 - 37007268
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| ||||||||||||||||| ||||||||| ||||  |||||| ||||||||||||    
37007190 tgaacatgacgttttgcaaatacccctctgaagttttgcacttacgtgcaaaatacccc-aaaacttaaaaatttatatt 37007268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #134
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 45856920 - 45856999
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| ||||| || |||||||||||||||||||||| |||  ||||||| ||||||||||||    
45856920 tgaacatgatgttttgcaaatacccccttaaagttttgcacttatgtgcaaaataccctccaaacttaaaaatttatatt 45856999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #135
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 1493750 - 1493704
Alignment:
108 ttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||    
1493750 ttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc 1493704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #136
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 21125642 - 21125585
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||    
21125642 aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc 21125585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #137
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 35498754 - 35498812
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||||    
35498754 tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc 35498812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #138
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 44472792 - 44472710
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||  ||||||||||| ||| ||||||||||||| |||||||||||| |  || |||||||||||||||||||||||    
44472792 tgaacatgatattttgcaaatacccctctgaagttttgcatttatgtgcaaaaagttccccaaacttgaaaatttatattttt 44472710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #139
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 46229577 - 46229662
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttat------gtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||      |||||||||||||| ||||||| ||||||||||||    
46229577 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaagtgcaaaatgccccccaaacttaaaaatttatatt 46229662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #140
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 22599455 - 22599375
Alignment:
97 tgaacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| |  ||||||||||| ||||||||||||||||| ||| | ||||| || |||||||||    
22599455 tgaacatgacgttttgcaaatatactccctgaagttttacacttatgtgcaaaatgtcccacgaacttaaatatttatatt 22599375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #141
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 153
Target Start/End: Original strand, 26931423 - 26931480
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccc 153  Q
    |||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||    
26931423 tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccc 26931480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #142
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 47170319 - 47170402
Alignment:
97 tgaacatgacgttttgcaaatatcccc------tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||      ||| ||||||||||||||||||||||||||| ||||||| ||||||||||||    
47170319 tgaacatgacgttttgcaaataccccccccccctgaggttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 47170402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #143
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 5198364 - 5198440
Alignment:
99 aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||| |||||| | ||||||||||||||||||||||||||||||| | | ||||| |||||||||||    
5198364 aacatgacattttgtaaatattctcctgaagttttgcacttatgtgcaaaatgccacccgaacttaaaaatttatat 5198440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #144
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 120 - 175
Target Start/End: Original strand, 12231270 - 12231326
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgc-aaacttgaaaatttatatt 175  Q
    |||||||| |||||||||||||||||||||||||| | |||||||||||||||||||    
12231270 cccctgaaattttgcacttatgtgcaaaatgcccccctaaacttgaaaatttatatt 12231326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #145
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 26932033 - 26931950
Alignment:
97 tgaacatgacgttttgcaaata--tcccctgaagttttgcact----tatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||   ||||||||||||||||||    ||||||||||||||||| ||||||| ||||||||||||    
26932033 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatatatgtgcaaaatgcccc-caaacttaaaaatttatatt 26931950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #146
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 29644965 - 29644889
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| |||| ||| |||||||||||||||||||||||||||   ||||||||||| |||||    
29644965 aacatgatgttttgcaaatacccccctgaggttttgcacttatgtgcaaaatgccccatgaacttgaaaatatatat 29644889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #147
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 33228543 - 33228467
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||  ||||||||||| |||| |||| |||||||||||||||||||||||||| | |||||||| ||||||||    
33228543 aacatgaaattttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccgaacttgaatatttatat 33228467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #148
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 33696623 - 33696699
Alignment:
99 aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| ||| |||||||| || |||| ||||||||||||||||||||||||| || | |||||||||||||||||    
33696623 aacatgatgttctgcaaataacctcctggagttttgcacttatgtgcaaaatgctccccgaacttgaaaatttatat 33696699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #149
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 8296385 - 8296440
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| ||||||||||||||||||||||||||  |||||| |||||||||||||||    
8296385 ctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt 8296440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #150
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 119 - 174
Target Start/End: Original strand, 16083138 - 16083193
Alignment:
119 tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||||||||||||| |||  ||||||||||||||||||    
16083138 tcccctgaaattttgcacttatgtgcaaaatgacccttaaacttgaaaatttatat 16083193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #151
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 18120383 - 18120462
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||| ||||| |||| ||||||||||||||||||||| | ||| ||| ||||||| ||||||||||||    
18120383 tgaacatgatgttttggaaatacccccctgaagttttgcacttatgtgcgatatgtcccccaaacttaaaaatttatatt 18120462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #152
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 18830197 - 18830123
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||| | |||| |||||||||||||||||||||  |||||||||||| | ||||| |||||||||||    
18830197 aacatgacgttttcctaataccccctgaagttttgcacttataagcaaaatgcccc-cgaacttaaaaatttatat 18830123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #153
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 113 - 171
Target Start/End: Complemental strand, 12231967 - 12231909
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    ||||||||||| ||| ||||||||||||||||||||||||||  |||||| ||||||||    
12231967 caaatatcccccgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta 12231909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #154
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 15752357 - 15752438
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||| ||||||||||  | | |||||||||||||||||||| || |||   |||||||||||||||||||||    
15752357 aacatgacgttttgtaaatatcccccttaacgttttgcacttatgtgcaaagtgtcccttgaacttgaaaatttatattttt 15752438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #155
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 102 - 167
Target Start/End: Complemental strand, 17775276 - 17775210
Alignment:
102 atgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa 167  Q
    |||||||||| |||||| || |||||||||||||| ||||||||||||||||||  |||||||||||    
17775276 atgacgttttacaaatactctcctgaagttttgcagttatgtgcaaaatgccccctaaacttgaaaa 17775210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #156
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 19071598 - 19071656
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
19071598 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 19071656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #157
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 28294397 - 28294455
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
28294397 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 28294455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #158
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 28311642 - 28311700
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
28311642 cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt 28311700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #159
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 35667918 - 35667976
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
35667918 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 35667976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #160
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 39767530 - 39767472
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
39767530 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 39767472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #161
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 124 - 174
Target Start/End: Original strand, 45259058 - 45259108
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||||||||| ||||||| |||||||||||    
45259058 tgaagttttgcacttatgtgtaaaatgccccccaaacttaaaaatttatat 45259108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #162
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 97 - 149
Target Start/End: Complemental strand, 5852486 - 5852433
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaat 149  Q
    |||||||||||||||||||||| || ||||||||||||||||||||| ||||||    
5852486 tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtacaaaat 5852433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #163
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 166
Target Start/End: Original strand, 9494951 - 9495004
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaa 166  Q
    |||||| |||||||||||||||||||||||||||||||| || | |||||||||    
9494951 caaataccccctgaagttttgcacttatgtgcaaaatgcaccccgaacttgaaa 9495004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #164
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 178
Target Start/End: Complemental strand, 9495662 - 9495589
Alignment:
102 atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||| ||||||  ||||||||||||||||||||||| |||||||| | | ||||||||||||||| |||||    
9495662 atgacgttttccaaata--ccctgaagttttgcacttatgtgtaaaatgccac-cgaacttgaaaatttatgttttt 9495589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #165
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 11456432 - 11456352
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||| |||||  ||||| ||||||||||||||||||||  | | ||||||  ||||||||||||    
11456432 tgaacatgacgttttgcaaatgtcccccctgaaggtttgcacttatgtgcaaaataactcccaaactaaaaaatttatatt 11456352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #166
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 37710695 - 37710744
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt 169  Q
    |||||||| ||||||||||||||||||||||||||  |||||||||||||    
37710695 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatt 37710744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #167
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 40260553 - 40260488
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| ||||||| |||||||||||||||||||||||||   |||||| |||||||| ||||||    
40260553 caaatattccctgaaattttgcacttatgtgcaaaatgccctctaaacttaaaaatttagattttt 40260488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #168
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 41798447 - 41798512
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| ||||| || ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
41798447 caaataccccctaaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 41798512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #169
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 22992099 - 22992174
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| | || ||||||||||||||||||||| || | | |||||||||||||||||    
22992099 aacatgacgttttgcaaatacccccctaaaattttgcacttatgtgcaaaattcctc-cgaacttgaaaatttatat 22992174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #170
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 27316310 - 27316366
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||| |||| | ||||||||||||||||||||| |||||||    
27316310 aacatgacgttttgcaaatacccccctcaagttttgcacttatgtgcaacatgcccc 27316366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #171
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 102 - 178
Target Start/End: Original strand, 42260819 - 42260895
Alignment:
102 atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||| ||||| ||||| || |||||||||||| |||||||||| ||   || ||||||||||||||||||    
42260819 atgacgttttgtaaataccccctaaaattttgcacttatatgcaaaatgctccatgaatttgaaaatttatattttt 42260895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #172
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 22022956 - 22022881
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||| | |||||||||||||||||||  ||||||| | || | ||| |||||||||||||    
22022956 aacatgacattttgcaaatacctcctgaagttttgcacttataggcaaaatacaccccgaacatgaaaatttatat 22022881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #173
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 30163467 - 30163392
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||  ||||| |||||| ||| ||| ||||||||||||||||||||| ||||  |||||| |||||||||||    
30163467 aacatgaaattttgtaaatattccccgaaattttgcacttatgtgcaaaataccccctaaacttaaaaatttatat 30163392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #174
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 33210419 - 33210470
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||||||||||| |||  ||||||||||||||||||    
33210419 ctgaaattttgcacttatgtgcaaaatgtcccctaaacttgaaaatttatat 33210470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #175
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 149
Target Start/End: Complemental strand, 34486829 - 34486778
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaat 149  Q
    |||||||||||||||||||| ||||||| |||||| ||||||||||||||||    
34486829 aacatgacgttttgcaaatactcccctggagttttacacttatgtgcaaaat 34486778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #176
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 112 - 174
Target Start/End: Original strand, 44157603 - 44157666
Alignment:
112 gcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||| |||||||||||||||||||||||||||  |   |||||||||||||||||    
44157603 gcaaatatccccttgaagttttgcacttatgtgcaaaatgcttcatgaacttgaaaatttatat 44157666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #177
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 4236277 - 4236327
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    |||| ||| ||||||||||||||||||||||||||  ||||||||||||||    
4236277 cccccgaaattttgcacttatgtgcaaaatgccccataaacttgaaaattt 4236327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #178
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 4237101 - 4237043
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| || ||||||||||||||||||||||||||  |||||| ||| |||||||||||    
4237101 cccctcaaattttgcacttatgtgcaaaatgccccataaacttaaaagtttatattttt 4237043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #179
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 16083712 - 16083654
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||||||||||||| |||  |||||| |||||||| ||||||    
16083712 cccctgaaattttgcacttatgtgcaaaatgacccttaaacttaaaaatttagattttt 16083654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #180
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 22598914 - 22598991
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||||||  || ||||| |||||||||| ||||||||||||  | | |||||||||||||||||    
22598914 tgaacatgacgttttgcaaatacacctctgaaattttgcacttttgtgcaaaatgcttc-cgaacttgaaaatttatat 22598991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #181
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 37711242 - 37711188
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
37711242 tgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 37711188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #182
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 38184876 - 38184818
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||| |||||||| |||| |||||| |||||||| ||||||    
38184876 cccctgaaattttgcacttatgcgcaaaatgtcccgtaaacttaaaaatttagattttt 38184818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #183
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 38449965 - 38450019
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| |||||||||||||||||||||| |||  |||||| |||||||||||    
38449965 cccctgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaatttatat 38450019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #184
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 38450666 - 38450600
Alignment:
113 caaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||| ||| |||||||||||||||||||||| |||  |||||| |||||||| ||||||    
38450666 caaatatccccttgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaatttagattttt 38450600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #185
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 39880711 - 39880653
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||  ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
39880711 cccctgatattttgcacttatgtgcaaaatgccccttaaacttaaaaatttagattttt 39880653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #186
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 174
Target Start/End: Complemental strand, 34345907 - 34345846
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||| ||||| || |||||||||||||||||||||| |||   |||||||||||||||||    
34345907 caaataccccctaaaattttgcacttatgtgcaaaatgtcccctcaacttgaaaatttatat 34345846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #187
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 129 - 178
Target Start/End: Complemental strand, 35668455 - 35668406
Alignment:
129 ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||| ||||||||||  |||||| |||||||||||||||    
35668455 ttttgcacttatgtgtaaaatgccccctaaacttaaaaatttatattttt 35668406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #188
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 154
Target Start/End: Original strand, 39880164 - 39880205
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||| |||||||| ||||||||||||||||||||||||||    
39880164 caaataccccctgaaattttgcacttatgtgcaaaatgcccc 39880205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #189
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 48344279 - 48344214
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| |||||||||||||||  |||||||||  |||||| |||||||| ||||||    
48344279 caaataccccctgaaattttgcacttatgtgataaatgccccctaaacttaaaaatttagattttt 48344214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #190
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 39766980 - 39767036
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||||| |||||||||| | |||||||| ||||  ||||||||||||||||||||    
39766980 cccctgaaattttgcacttctatgcaaaataccccctaaacttgaaaatttatattt 39767036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #191
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 42491417 - 42491341
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||| |||||||| |||||| |||| |||||||||  |||||||||||||||| ||| | ||||| |||||||||||    
42491417 aacacgacgttttacaaatacccccctgaagttttatacttatgtgcaaaatgtccctcgaacttaaaaatttatat 42491341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #192
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 14103871 - 14103794
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgca--aacttgaaaatttatat 174  Q
    ||||||||||||| |||||| |||| |||||||||| | ||||||| |||||||||| ||  |||||||||||||||||    
14103871 aacatgacgtttttcaaatacccccctgaagttttgtatttatgtgtaaaatgcccc-catgaacttgaaaatttatat 14103794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #193
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 14413888 - 14413811
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgca--aacttgaaaatttatat 174  Q
    ||||||||||||| |||||| |||| |||||||||| | ||||||| |||||||||| ||  |||||||||||||||||    
14413888 aacatgacgtttttcaaatacccccctgaagttttgtatttatgtgtaaaatgcccc-catgaacttgaaaatttatat 14413811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #194
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 15753279 - 15753201
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||| ||||||| ||||||||||| ||||||||||| ||||||  |||   ||||| ||||||||| |||||    
15753279 aacatgacgttt-gcaaataccccctgaagttatgcacttatgtacaaaatatcccctgaacttaaaaatttatgttttt 15753201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #195
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 151
Target Start/End: Original strand, 19557437 - 19557484
Alignment:
104 gacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc 151  Q
    ||||||||||||||| | | |||||||||||| |||||||||||||||    
19557437 gacgttttgcaaataccacgtgaagttttgcatttatgtgcaaaatgc 19557484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #196
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 167
Target Start/End: Complemental strand, 28312467 - 28312420
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa 167  Q
    |||||||| ||||||||||||||||||||||||||  |||||| ||||    
28312467 cccctgaaattttgcacttatgtgcaaaatgccccctaaactttaaaa 28312420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #197
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 154
Target Start/End: Original strand, 14313050 - 14313084
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||| ||||||||||||||||||||||||||    
14313050 cccctgaaattttgcacttatgtgcaaaatgcccc 14313084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #198
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 14313611 - 14313553
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||| ||||| |||||||||||  |||||| |||||||| ||||||    
14313611 cccctgaaattttgcacctatgtacaaaatgccccctaaacttaaaaatttagattttt 14313553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #199
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 103 - 152
Target Start/End: Complemental strand, 21387200 - 21387150
Alignment:
103 tgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgcc 152  Q
    |||| ||||||||||| ||| ||||||||||| ||||||||||||||||||    
21387200 tgacattttgcaaatacccctctgaagttttgtacttatgtgcaaaatgcc 21387150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #200
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 97 - 134
Target Start/End: Original strand, 24646297 - 24646335
Alignment:
97 tgaacatgacgttttgcaaatat-cccctgaagttttgc 134  Q
    ||||||||||||||||||||||| |||||||||||||||    
24646297 tgaacatgacgttttgcaaatatccccctgaagttttgc 24646335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #201
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 165
Target Start/End: Original strand, 28293530 - 28293575
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaa 165  Q
    |||||||| |||||||||||||||| |||||||||  |||||||||    
28293530 cccctgaaattttgcacttatgtgcgaaatgccccataaacttgaa 28293575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #202
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 120 - 152
Target Start/End: Complemental strand, 10546590 - 10546558
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgcc 152  Q
    ||||| |||||||||||||||||||||||||||    
10546590 cccctaaagttttgcacttatgtgcaaaatgcc 10546558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #203
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 144
Target Start/End: Complemental strand, 17898014 - 17897974
Alignment:
105 acgttttgcaaatatccc-ctgaagttttgcacttatgtgc 144  Q
    |||||||||||||| ||| ||||||||||||||||||||||    
17898014 acgttttgcaaataccccactgaagttttgcacttatgtgc 17897974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #204
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 44679101 - 44679153
Alignment:
99 aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatg 150  Q
    ||||||||||||||||||||||  |||||| ||||||||| || |||||||||    
44679101 aacatgacgttttgcaaatatcttcctgaaattttgcactaatatgcaaaatg 44679153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0196 (Bit Score: 70; Significance: 3e-31; HSPs: 1)
Name: scaffold0196
Description:

Target: scaffold0196; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 6575 - 6494
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||    
6575 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt 6494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 69; Significance: 1e-30; HSPs: 189)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 98 - 178
Target Start/End: Complemental strand, 29119831 - 29119751
Alignment:
98 gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||||||||    
29119831 gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatattttt 29119751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 14244401 - 14244479
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
14244401 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 14244479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 14450711 - 14450633
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
14450711 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 14450633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 29119222 - 29119300
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
29119222 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 29119300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 9737106 - 9737030
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
9737106 aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 9737030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 10443193 - 10443272
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
10443193 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 10443272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 15731491 - 15731570
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
15731491 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 15731570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 15732101 - 15732022
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
15732101 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 15732022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 18809704 - 18809783
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
18809704 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 18809783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 40520912 - 40520833
Alignment:
96 atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
40520912 atgaacatgacgttttgcaaataccacctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 40520833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1077322 - 1077399
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
1077322 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 1077399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1587984 - 1588062
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
1587984 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 1588062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7723260 - 7723338
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
7723260 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 7723338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7723866 - 7723788
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
7723866 tgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 7723788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 9116208 - 9116130
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||| ||||||||||||    
9116208 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatatgcaaaataccccccaaacttaaaaatttatatt 9116130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36508470 - 36508392
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
36508470 tgaacatgacgttttacaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 36508392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 43433643 - 43433566
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
43433643 tgaacatgacgttttgcaaatatccc-tgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 43433566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 43924290 - 43924212
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
43924290 tgaatatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 43924212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 35771641 - 35771721
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||    
35771641 tgaacataacgttttgcaaatatcccatgaaattttgcacttatgtgcaaaatgccccg-aaacttgaaaatttatattttt 35771721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 97 - 176
Target Start/End: Original strand, 43084954 - 43085034
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
43084954 tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattt 43085034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 355916 - 355837
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
355916 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 355837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 104 - 175
Target Start/End: Complemental strand, 5220468 - 5220397
Alignment:
104 gacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
5220468 gacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 5220397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 14053929 - 14053850
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
14053929 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 14053850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 15207577 - 15207656
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
15207577 tgaacatgacgttttgcaaatacttccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt 15207656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21559785 - 21559706
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
21559785 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 21559706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24573406 - 24573485
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
24573406 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 24573485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 25630312 - 25630391
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||   |||||||||||||||||||||    
25630312 aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccctgaacttgaaaatttatattttt 25630391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32989877 - 32989798
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
32989877 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 32989798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36893895 - 36893974
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
36893895 tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 36893974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36894504 - 36894425
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
36894504 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 36894425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 37747131 - 37747052
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||    
37747131 aacataacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccgaactttaaaatttatattttt 37747052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40520290 - 40520369
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
40520290 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 40520369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41258048 - 41257969
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
41258048 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 41257969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43284352 - 43284431
Alignment:
97 tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
43284352 tgaacatgacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 43284431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43923411 - 43923490
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||| ||||||||||||    
43923411 tgaacatgacgttttgcaaatatccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt 43923490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1650483 - 1650561
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||| ||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
1650483 tgaacaagacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 1650561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 101 - 175
Target Start/End: Original strand, 5219910 - 5219984
Alignment:
101 catgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||  ||||||| ||||||||||||    
5219910 catgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt 5219984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 5794716 - 5794794
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| | ||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||    
5794716 tgaacatgacgttttgcaaataccacctgaagttttgcacttgtgtgcaaaatgccccccaaacttaaaaatttatatt 5794794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 14053322 - 14053400
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||| ||||||| ||||||||||||    
14053322 tgaacatgacgttttgcaaataccccatgaagttttgcacttatgtacaaaatgccccccaaacttaaaaatttatatt 14053400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 20832761 - 20832683
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| ||||||||||||||||||||||||||||| ||||||||||||||| ||||  |||||||||||||||||||||    
20832761 aacataacgttttgcaaatatcccctgaagttttgtacttatgtgcaaaataccccataaacttgaaaatttatatttt 20832683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23916030 - 23916107
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
23916030 tgaacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 23916107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26430664 - 26430741
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||| ||||||||||||    
26430664 tgaacatgacgttttgcaaatatcccctgaagttttgcacttaagtacaaaatgcccc-caaacttaaaaatttatatt 26430741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 29100760 - 29100837
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
29100760 tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatat 29100837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 33880616 - 33880538
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||    
33880616 tgaacatgacattttgcaaataccccctgaagttttgctcttatgtgcaaaatgccccccaaacttaaaaatttatatt 33880538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39407804 - 39407727
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
39407804 tgaacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 39407727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 17961073 - 17960993
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
17961073 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 17960993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43433035 - 43433115
Alignment:
97 tgaacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
43433035 tgaacatgacgttttgcaaataccccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 43433115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 97 - 176
Target Start/End: Complemental strand, 29101224 - 29101144
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||    
29101224 tgaacatgacgttttgcaaatactcacctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatattt 29101144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 37429547 - 37429467
Alignment:
96 atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
37429547 atgaacatgacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 37429467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 41450411 - 41450336
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||   | ||||||||||||||||||||    
41450411 aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcc---cgaacttgaaaatttatatttt 41450336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1651038 - 1650959
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||| || ||||||| ||||||||||||    
1651038 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcaccccaaacttaaaaatttatatt 1650959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 3416802 - 3416881
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| |||||||||||||| |||||||||||||||||||||||||||||||  || | |||||||||||||||||||||    
3416802 aacatcacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgttccccgaacttgaaaatttatattttt 3416881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 3454767 - 3454846
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| ||||||| ||||||||||||    
3454767 tgaacatgacgttttgcaaatacccccatgaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttatatt 3454846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 10825429 - 10825508
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
10825429 tgaacatgacgttttacaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 10825508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 11856147 - 11856226
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| |||| |||||||||||| ||||||||||||| ||||||| ||||||||||||    
11856147 tgaacatgacgttttgcaaatatccccctgaaattttgcacttatatgcaaaatgccccccaaacttaaaaatttatatt 11856226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 14450102 - 14450181
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
14450102 tgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 14450181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 15211506 - 15211427
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
15211506 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 15211427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17960463 - 17960542
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||| ||| ||||||||    
17960463 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgacccccaaacttaaaagtttatatt 17960542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 21558895 - 21558974
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||| | ||||||||||||    
21558895 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt 21558974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31127637 - 31127558
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||  |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
31127637 tgaacatatcgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 31127558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 33871874 - 33871953
Alignment:
97 tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||  |||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
33871874 tgaacatgacgttttgcaaataaaccccagaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 33871953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39407197 - 39407276
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
39407197 tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 39407276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 2657556 - 2657478
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| ||| | ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
2657556 tgaacataacgttttgcaaataccccataaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 2657478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 20166668 - 20166590
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||    
20166668 tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 20166590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 38713498 - 38713579
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| | |||||||||||||||| ||||    
38713498 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttataatttt 38713579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 26876 - 26796
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||||||||  ||||||||||||||||||||||||||| |||  |||||||||||||||||||||    
26876 aacataacgttttgcaaatatcccccctgaagttttgcacttatgtgcaaaatgtcccctaaacttgaaaatttatatttt 26796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 3927713 - 3927636
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||  |||||| ||||||||||||    
3927713 aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt 3927636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 14245010 - 14244930
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
14245010 tgaacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 14244930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 35942749 - 35942669
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
35942749 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 35942669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 36468990 - 36469067
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
36468990 aacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaactttaaaatttatatt 36469067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39324594 - 39324674
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||  |||||| ||||||||||||    
39324594 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt 39324674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 355308 - 355388
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||| ||||||| ||||||||||||    
355308 tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttatatt 355388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 11650882 - 11650965
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||  ||| || |||||||||||||||    
11650882 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccccaaaatttaaaaatttatattttt 11650965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13002129 - 13002049
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaactt-gaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||  ||||||||||||    
13002129 tgaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaaatttatatt 13002049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 17925211 - 17925135
Alignment:
99 aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||||  ||||||||||||| ||||||||||||||||||||| | |||||||||||||||||    
17925211 aacatgacgttttgcaaatacgcccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat 17925135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 27072586 - 27072503
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||||||||  ||||||||||||||||||| ||||||| ||| | ||||||||| |||||||||||    
27072586 tgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgttcaaaatgtcccccgaacttgaaattttatattttt 27072503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 36255637 - 36255561
Alignment:
99 aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||||| ||| |||||||    
36255637 aacatgacgttttgcaaatatcgccctgaagttttgcacttatgtgcaaaatgccccccgaacttaaaattttatat 36255561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39133248 - 39133168
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccg-caaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
39133248 tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccctgccaaacttaaaaatttatatt 39133168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 40450540 - 40450464
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| | |||||||||||||||||    
40450540 aacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat 40450464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 2656948 - 2657027
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| || |||| ||||||||||||    
2656948 tgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccagacttaaaaatttatatt 2657027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 5690540 - 5690615
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||   | ||||| |||||||||||    
5690540 aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccttccgaacttaaaaatttatat 5690615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 5795324 - 5795245
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||| ||||||||||||||| || ||||||| ||||||||||||    
5795324 tgaacatgacgttttgcaaatacccccatgaagttttgcatttatgtgcaaaatgctccccaaacttaaaaatttatatt 5795245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 25094265 - 25094344
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||  |||||| ||||||||||||||    
25094265 aacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatttt 25094344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 33872967 - 33873045
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
33872967 tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 33873045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41257439 - 41257518
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||| |||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
41257439 tgaacatgacggtttgcaaatacccccctgaagttttgcacttatgtgcaaaatggcccccaaacttaaaaatttatatt 41257518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 44308242 - 44308317
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||   |||||||||||||||||    
44308242 aacatgacattttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccttgaacttgaaaatttatat 44308317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 17924634 - 17924716
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||| |||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| ||||||||| |||||    
17924634 tgaacatgaagttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatgttttt 17924716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 23564014 - 23564095
Alignment:
99 aacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| |||||||||||||||||  |||||||||||||||||  |||||||||||||| | |||||||||||||||||||||    
23564014 aacatcacgttttgcaaatatcctccctgaagttttgcacttcagtgcaaaatgccccccgaacttgaaaatttatattttt 23564095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 98 - 160
Target Start/End: Complemental strand, 33872754 - 33872692
Alignment:
98 gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaac 160  Q
    ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||||    
33872754 gaacatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaac 33872692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 38713882 - 38713965
Alignment:
97 tgaacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| ||||   ||||||||||||||||||||||||||||||| | |||||||||||||||| ||||    
38713882 tgaacatgacgttttgcaaatacccccccctgaagttttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttataatttt 38713965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 38714773 - 38714692
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||||  |||| |||||||||||||||||||||||| | | |||||||||||||||||||||    
38714773 aacatgacgttttgcaaataccccccctgaaattttgcacttatgtgcaaaatgcctcccgaacttgaaaatttatattttt 38714692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 3177933 - 3177998
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
3177933 caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 3177998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 10308567 - 10308488
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| ||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
10308567 tgaatatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 10308488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 11651426 - 11651342
Alignment:
97 tgaacatgacgttttgcaaatatcccc------tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||      ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
11651426 tgaacatgacgttttgcaaataccccccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 11651342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 12764236 - 12764301
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
12764236 caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 12764301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 26431542 - 26431462
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||   |||||||||||||||||||||||| |||||| ||| ||||||| ||||||||||||    
26431542 tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgtaaaatgtcccacaaacttaaaaatttatatt 26431462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 31917939 - 31918019
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  |||||||||||| ||||||||||||||| || ||||||| ||||||||||||    
31917939 tgaacatgacgttttgcaaataccccccctgaagttttgcatttatgtgcaaaatgctccccaaacttaaaaatttatatt 31918019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 6653892 - 6653812
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||   | |||||||||||||||||||||    
6653892 aacatgacgttttgcaaatatccccctgaatttttgcacttacgtgcaaaatgccttccgaacttgaaaatttatattttt 6653812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 6734292 - 6734212
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||   | |||||||||||||||||||||    
6734292 aacatgacgttttgcaaatatccccctgaatttttgcacttacgtgcaaaatgccttccgaacttgaaaatttatattttt 6734212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 9114801 - 9114877
Alignment:
98 gaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata 173  Q
    ||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||  ||||||| ||||||||||    
9114801 gaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcctccaaacttaaaaatttata 9114877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 98 - 171
Target Start/End: Original strand, 9736243 - 9736318
Alignment:
98 gaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||| |||||| |||| || ||||||||    
9736243 gaacatgacgttttgcaaatattccccctgaagttttgcacttatgtgcaaactgccccccaaatttaaaaattta 9736318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 172
Target Start/End: Original strand, 10307836 - 10307912
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    ||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||  ||||||| |||||||||    
10307836 tgaacattacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttat 10307912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 11178854 - 11178913
Alignment:
97 tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||    
11178854 tgaacatgacgttttgcaaatacatcccctgaagttttgcacttatgtgcaaaatgcccc 11178913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 7482772 - 7482697
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||| | || ||||||||||||||||||||||||||  |||||| |||||||||||    
7482772 aacatgacgttttgcaaataccccataaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatat 7482697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13001522 - 13001600
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| | |||||||||||||||| ||||||||||||| ||||||| ||||||||||||    
13001522 tgaacatgacgttttgcaaataccccgttgaagttttgcacttatatgcaaaatgcccc-caaacttaaaaatttatatt 13001600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 15730634 - 15730689
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||    
15730634 aacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc 15730689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 17733882 - 17733827
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||    
17733882 aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatacccc 17733827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 32989269 - 32989348
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| ||| | |||| | ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
32989269 tgaacatgacgttttgtaaacacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 32989348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39132868 - 39132947
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| ||| | |||||||||||||||||||||||||||||| ||| ||| ||||||||||||    
39132868 tgaacatgacattttgcaaatacccctccgaagttttgcacttatgtgcaaaatgccccccaatcttaaaaatttatatt 39132947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39325168 - 39325096
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||      |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
39325168 tgaacatgacgttttgcaaata------gaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 39325096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 44445528 - 44445449
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||  |||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||    
44445528 tgaacatgaagttttgcaaatgctcccctgaagttttacacttatgtgcaaaatgtccccgcaaacttaaaaatttatat 44445449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 9879219 - 9879142
Alignment:
99 aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||||  |||| |||| ||||||||||||||||||||||||||  |||||| |||||||||||    
9879219 aacatgacgttttgcaaatacctcccatgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatat 9879142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 15602030 - 15601954
Alignment:
99 aacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||  ||||||||||||||||||||||||||||||||| | ||||| |||||||||||    
15602030 aacatgacgttttgcaaataccctacctgaagttttgcacttatgtgcaaaatgcccc-ccaacttaaaaatttatat 15601954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31918544 - 31918467
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| | |||||||||||| ||||||||||||| ||||||||||||||||||| | ||||||| ||||||||||||    
31918544 tgaacattatgttttgcaaataacccctgaagttttacacttatgtgcaaaatgcctc-caaacttaaaaatttatatt 31918467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 37428668 - 37428745
Alignment:
99 aacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||||||||||||||||| ||||| || |||||||||||||||||||||| |||| ||||||| |||||||||||||    
37428668 aacatgacgttttgcaaatacccccttaaagttttgcacttatgtgcaaaat-ccccccaaacttaaaaatttatattt 37428745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 101 - 154
Target Start/End: Complemental strand, 39864170 - 39864116
Alignment:
101 catgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
39864170 catgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgcccc 39864116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 12383208 - 12383288
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||| ||||||| | | ||||||| ||||||||||||    
12383208 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgttcaaaatgactcccaaacttaaaaatttatatt 12383288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 27071711 - 27071792
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| |||||||||||||| |||||||| || ||||||||||| |||||||||||   ||||| |||||||||||||||    
27071711 tgaacataacgttttgcaaataccccctgaaattgtgcacttatgttcaaaatgccccttgaacttaaaaatttatattttt 27071792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 159
Target Start/End: Complemental strand, 28776745 - 28776681
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaa 159  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||    
28776745 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaa 28776681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 41450066 - 41450139
Alignment:
102 atgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||| |||| ||||||||||||||||||| ||||||||||  | |||||||||||||||||    
41450066 atgacgttttgcaaatacccccatgaagttttgcacttatgtacaaaatgccctccgaacttgaaaatttatat 41450139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 43085704 - 43085624
Alignment:
97 tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||  |||| ||||||  ||||||||||||||||||||||||||||||||||||  |||||| ||||||||||||    
43085704 tgaacatgatattttacaaatacctcccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt 43085624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 168
Target Start/End: Original strand, 3926005 - 3926077
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaat 168  Q
    |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||  || ||||||| |||||    
3926005 tgaacatgacgttttgcaaataccccgctgaagttttgcacttatgtgcaaaatgttcctcaaacttaaaaat 3926077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 152
Target Start/End: Complemental strand, 10831293 - 10831237
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcc 152  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||    
10831293 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcc 10831237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 20166085 - 20166163
Alignment:
99 aacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||||||   ||||||||| ||||||||||||||||| ||| | |||||||| ||||||||    
20166085 aacatgacgttttgcaaatatccccccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaagatttatat 20166163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 171
Target Start/End: Original strand, 23564795 - 23564867
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    ||||| |||||||| ||||| | |||||||||||||||||||||||||||||| || | ||||||||||||||    
23564795 aacatcacgttttgtaaatacctcctgaagttttgcacttatgtgcaaaatgcaccccgaacttgaaaattta 23564867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #126
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 28776135 - 28776211
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||  ||||||| ||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
28776135 tgaacatgacgtt--gcaaatacccctctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 28776211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #127
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1077927 - 1077849
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| ||  |||||||||||||||||||||||||||||||| ||||||| |||| |||||||    
1077927 tgaacatgacattttgcaaatacccgtctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaaattatatt 1077849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #128
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 5691466 - 5691387
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| |||||||| ||||| ||||||||||||||||||||  ||||||||||| |  ||||||||||||||||| ||||    
5691466 aacatcacgttttgtaaataccccctgaagttttgcacttacatgcaaaatgccgctgaaacttgaaaatttataatttt 5691387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #129
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36507885 - 36507963
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| |||| ||| |||||||||||||||||||||| |||| ||||||| ||||||||||||    
36507885 tgaacatgacgttttacaaatacccccctgaggttttgcacttatgtgcaaaatacccc-caaacttaaaaatttatatt 36507963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #130
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 179
Target Start/End: Complemental strand, 36573628 - 36573546
Alignment:
99 aacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttg 179  Q
    |||||||||||||||||||| ||  |||||||||||||||||||||||||||||| ||   ||||| |||||||||| |||||    
36573628 aacatgacgttttgcaaataacctccctgaagttttgcacttatgtgcaaaatgctcctttaacttaaaaatttataattttg 36573546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #131
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 151
Target Start/End: Complemental strand, 11179950 - 11179896
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc 151  Q
    |||||||||  ||||||||||| ||||||||||||||||||||||||||||||||    
11179950 tgaacatgatattttgcaaataccccctgaagttttgcacttatgtgcaaaatgc 11179896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #132
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 31204030 - 31204087
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
31204030 cccctgaaattttgcacttatgtgcaaaatgcccc-taaacttgaaaatttatattttt 31204087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #133
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 33852911 - 33852854
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||    
33852911 cccctgaagttttgcacttatgtgcaaaatgccac-cgaacttgaaaatttatattttt 33852854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #134
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 41392689 - 41392747
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||| ||||||||||||||||||    
41392689 cccctgaaattttgcacttatgtgcaaaatgccccctaaatttgaaaatttatattttt 41392747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #135
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 42994489 - 42994431
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||| ||||||||||||||||||    
42994489 cccctgaaattttgcacttatgtgcaaaatgccccctaaatttgaaaatttatattttt 42994431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #136
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 44444944 - 44445021
Alignment:
99 aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||| |||||||||||||||  |||||||||||||| ||||||||| ||||||||||| | || ||||||||||||||    
44444944 aacacgacgttttgcaaatacctcccctgaagttttacacttatgtacaaaatgccccccgaatttgaaaatttatat 44445021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #137
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 44671967 - 44671909
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||| ||||||    
44671967 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttagattttt 44671909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #138
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 35942164 - 35942217
Alignment:
122 cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||||||||| |||| || ||||||||||||    
35942164 cctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt 35942217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #139
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 25953 - 26029
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||| |||||| || ||| |||||||| ||||||||||||||||||||   |||||||||||||||||    
25953 aacatgacgttttacaaatactctcctaaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttatat 26029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #140
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 3419007 - 3418926
Alignment:
99 aacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||    ||||||||||||||||||| ||||||||||| | ||||| |||||||||||||||    
3419007 aacatgacgttttgcaaatacccctccatgaagttttgcacttatgtccaaaatgcccc-cgaacttaaaaatttatattttt 3418926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #141
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 12503138 - 12503058
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||  |||| ||||||||||||||||||| |||||||  |   |||||||||||||||||||||    
12503138 aacatgacgttttgcaaatacacccttgaagttttgcacttatgtgtaaaatgcatcctgaacttgaaaatttatattttt 12503058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #142
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 15565576 - 15565500
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| |||||||||| |||||||||||||||| |||   ||||| |||||||||||    
15565576 aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgtcccctcaacttaaaaatttatat 15565500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #143
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 25631220 - 25631140
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||  ||||||||||| ||| | ||| ||||||||||||||||||||||||||   |||||||||||||||||||||    
25631220 aacatgaaattttgcaaataccccgttgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaatttatattttt 25631140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #144
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 31819852 - 31819908
Alignment:
99 aacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||| ||||| || |||||||||||||||||||||||||||    
31819852 aacatgacgttttgcaaatacccccttaaagttttgcacttatgtgcaaaatgcccc 31819908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #145
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 37746433 - 37746485
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg 150  Q
    |||||||||||||||||||||| || |||||||||||||||||||||||||||    
37746433 aacatgacgttttgcaaatatctccatgaagttttgcacttatgtgcaaaatg 37746485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #146
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 40449961 - 40450040
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||| |||| |||||||||||| ||||  ||||||| ||||||||||||||||||||||| ||||||| |||| ||||||    
40449961 tgaatatgaagttttgcaaataccccccctgaagttgtgcacttatgtgcaaaatgccccccaaacttaaaaacttatat 40450040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #147
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 41543206 - 41543150
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||||| ||||||||||||||||| ||||||||  ||||||||||||||||||||    
41543206 cccctgaaattttgcacttatgtgcagaatgccccctaaacttgaaaatttatattt 41543150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #148
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 32449087 - 32449161
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |   | ||||||||||||||||||||||||||| | ||||||| |||||||||||    
32449087 aacatgacgttttgcaaataccatataaagttttgcacttatgtgcaaaatgcctc-caaacttaaaaatttatat 32449161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #149
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 39863484 - 39863558
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||| |||||||||||| ||||||| |||||||||||| | | ||||| |||||||||||    
39863484 aacataacgttttgcaaataccccctgaagtttcgcactta-gtgcaaaatgcctcccgaactttaaaatttatat 39863558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #150
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 162
Target Start/End: Complemental strand, 43284922 - 43284858
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaactt 162  Q
    ||||||||||||||||||||||  ||||||||||||||||  ||||||||||||||||| |||||||    
43284922 tgaacatgacgttttgcaaatacccccctgaagttttgca--tatgtgcaaaatgcccctcaaactt 43284858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #151
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 30729061 - 30729007
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| |||||||||||||||||||||||||   ||||||||||||||||||||||    
30729061 tgaaattttgcacttatgtgcaaaatgcccactaaacttgaaaatttatattttt 30729007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #152
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 132 - 178
Target Start/End: Original strand, 41575089 - 41575135
Alignment:
132 tgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||||  ||||||||||||||||||||||    
41575089 tgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 41575135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #153
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 41576688 - 41576630
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
41576688 cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt 41576630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #154
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 44869079 - 44869022
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||||||||||    
44869079 cccctgaaattttgcacttatgtgcaaaatgcccc-taaacttaaaaatttatattttt 44869022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #155
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 99 - 152
Target Start/End: Original strand, 15564658 - 15564711
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcc 152  Q
    ||||| |||||||||||||| |||| ||||||||||||||||| ||||||||||    
15564658 aacataacgttttgcaaataccccccgaagttttgcacttatgagcaaaatgcc 15564711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #156
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 36740084 - 36740027
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||| ||||||||||||||||| ||  ||||||||||||||||| |||||||||||||    
36740084 tgaatatgacgttttgcaaataccctatgaagttttgcacttatatgcaaaatgcccc 36740027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #157
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 42356196 - 42356131
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||||||||||||||  ||| || |||||||| ||||||    
42356196 caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaatttaaaaatttagattttt 42356131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #158
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 4488796 - 4488740
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||||| |||||||||||||||||||| |||||  ||| ||||||||||||||||    
4488796 cccctgaaattttgcacttatgtgcaaaacgccccctaaatttgaaaatttatattt 4488740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #159
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 17732984 - 17733060
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||| || ||| |||||||| ||||||||||||||| ||||  |||||| |||||||||||    
17732984 aacatgacattttgcaaatactcacctaaagttttgtacttatgtgcaaaataccccttaaacttaaaaatttatat 17733060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #160
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 1143951 - 1143892
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaac-ttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||| || |||||||||||||||    
1143951 cccctgaaattttgcacttatgtgcaaaatgccccctaaactttaaaaatttatattttt 1143892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #161
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 12502229 - 12502304
Alignment:
99 aacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||  |||||||||||||| |||||||||||||| ||      |||||||||||||||||||    
12502229 aacatgacgttttgcaaatacccaccctgaagttttgcatttatgtgcaaaatgtcc------cttgaaaatttatattttt 12502304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #162
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 171
Target Start/End: Complemental strand, 12765033 - 12764982
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    |||||||| ||||||||||||||||||||||||||  |||||| ||||||||    
12765033 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta 12764982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #163
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 31204576 - 31204521
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
31204576 ctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 31204521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #164
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 34056020 - 34055965
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
34056020 ctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt 34055965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #165
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 178
Target Start/End: Original strand, 44629075 - 44629146
Alignment:
108 ttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||| || | |||||||||||||||||||||| ||||||   | |||||||||||||||||||||    
44629075 ttttgcaaataccctcatgaagttttgcacttatgtgcataatgccattcgaacttgaaaatttatattttt 44629146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #166
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 3178485 - 3178427
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||| |||||||||||||  |||||| |||||||| ||||||    
3178485 cccctgaaattttgcacttatctgcaaaatgccccttaaacttaaaaatttagattttt 3178427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #167
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 4484689 - 4484747
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||| ||||||||||||||  |||||| |||||||| ||||||    
4484689 cccctgaaattttgcacttaagtgcaaaatgccccctaaacttaaaaatttagattttt 4484747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #168
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 30728243 - 30728301
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||| |||||||||||||||||||||  |||||| |||||||| ||||||    
30728243 cccctgaaattttacacttatgtgcaaaatgccccttaaacttaaaaatttagattttt 30728301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #169
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 150
Target Start/End: Complemental strand, 35772476 - 35772422
Alignment:
97 tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatg 150  Q
    |||||||||| ||||||||||| | |||| |||||||||||||||||||||||||    
35772476 tgaacatgacattttgcaaataccgcccttaagttttgcacttatgtgcaaaatg 35772422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #170
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 36251952 - 36252029
Alignment:
99 aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| || |||||||||  ||||||||| |||||||||||||||||||||| | |  |||||| |||||||||||    
36251952 aacatgatgtattgcaaatacctcccctgaaattttgcacttatgtgcaaaatgtctcctaaacttaaaaatttatat 36252029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #171
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 37262455 - 37262397
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||||||||||||| |||  |||||| |||||||| ||||||    
37262455 cccctgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaatttagattttt 37262397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #172
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 39584540 - 39584482
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| || |||||||||||||||| ||||| |||  ||||||||||||||||||||||    
39584540 cccctaaaattttgcacttatgtgctaaatgtcccctaaacttgaaaatttatattttt 39584482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #173
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 41393512 - 41393454
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||  ||||||||||| |||||| |||||||| ||||||    
41393512 cccctgaaattttgcacttatgtataaaatgccccgtaaacttaaaaatttagattttt 41393454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #174
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 44671145 - 44671203
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||  || |||||||||||||||    
44671145 cccctgaaattttgcacttatgtgcaaaatgcccctaaactttaaaaatttatattttt 44671203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #175
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 150
Target Start/End: Complemental strand, 27575976 - 27575927
Alignment:
102 atgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatg 150  Q
    ||||||||||||||||| ||| |||||||||| |||||||||||||||||    
27575976 atgacgttttgcaaatacccctctgaagttttacacttatgtgcaaaatg 27575927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #176
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 29732721 - 29732645
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| ||| |||| |||| ||||||| |||||||| || |   |||||||||||||||||    
29732721 tgaacatgacgttttgcaaataccccttgaaattttacacttatatgcaaaatacctc-tgaacttgaaaatttatat 29732645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #177
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 174
Target Start/End: Complemental strand, 31820532 - 31820464
Alignment:
107 gttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||| ||| |||||||||| ||||||||||||||||| |||   ||||| |||||||||||    
31820532 gttttgcaaatacccctctgaagttttccacttatgtgcaaaatgtcccctgaactttaaaatttatat 31820464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #178
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 6869112 - 6869162
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg 150  Q
    ||||||||||||| |||||||  ||||||||||||||||||||| |||||||    
6869112 aacatgacgtttt-caaatatttcctgaagttttgcacttatgttcaaaatg 6869162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #179
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 164
Target Start/End: Original strand, 33851613 - 33851656
Alignment:
121 ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga 164  Q
    |||| ||||||||||||||||||||||||||||| | |||||||    
33851613 ccctaaagttttgcacttatgtgcaaaatgccccccgaacttga 33851656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #180
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 171
Target Start/End: Original strand, 44868533 - 44868584
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    |||||||| |||||||||||| |||||||||||||  |||||| ||||||||    
44868533 cccctgaaattttgcacttatatgcaaaatgccccctaaacttaaaaattta 44868584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #181
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 128 - 178
Target Start/End: Complemental strand, 9263887 - 9263837
Alignment:
128 gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||||| |    |||||||||||||||||||||    
9263887 gttttgcacttatgtgcaaaatgctctttgaacttgaaaatttatattttt 9263837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #182
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 124 - 170
Target Start/End: Original strand, 25617011 - 25617057
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    |||| ||||||||||||||||||||||||||  |||||| |||||||    
25617011 tgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattt 25617057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #183
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 154
Target Start/End: Original strand, 38256560 - 38256594
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||| ||||||||||||||||||||||||||    
38256560 cccctgaaattttgcacttatgtgcaaaatgcccc 38256594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #184
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 39583769 - 39583819
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    |||||||| ||||||||||||||||||||| ||||  |||||| |||||||    
39583769 cccctgaaattttgcacttatgtgcaaaataccccataaacttaaaaattt 39583819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #185
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 121 - 174
Target Start/End: Complemental strand, 15633319 - 15633266
Alignment:
121 ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| ||||  |||||||||||||||||||| | ||||| |||||||||||    
15633319 ccctgaaattttatacttatgtgcaaaatgcccccccaacttaaaaatttatat 15633266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #186
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 165
Target Start/End: Original strand, 37261909 - 37261954
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaa 165  Q
    |||||||| ||||||||||| ||||||||||||||  |||||||||    
37261909 cccctgaaattttgcacttacgtgcaaaatgccccctaaacttgaa 37261954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #187
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 177
Target Start/End: Complemental strand, 38257094 - 38257037
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    |||||||| |||||||||||||||||||||||| |  |||||| ||| |||| |||||    
38257094 cccctgaaattttgcacttatgtgcaaaatgcctcctaaacttaaaattttagatttt 38257037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #188
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 6870042 - 6869990
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg 150  Q
    |||||||| |||||||||||||||| | |||||||  ||||||||||||||||    
6870042 aacatgacattttgcaaatatccccttaaagtttttgacttatgtgcaaaatg 6869990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #189
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 128 - 172
Target Start/End: Complemental strand, 32449415 - 32449371
Alignment:
128 gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    |||||||||||||||||||||| |||  ||||||| |||||||||    
32449415 gttttgcacttatgtgcaaaataccctccaaacttaaaaatttat 32449371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 68; Significance: 4e-30; HSPs: 239)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 26537742 - 26537663
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||    
26537742 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccctcgaacttaaaaatttatattttt 26537663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17273050 - 17273128
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
17273050 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 17273128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31196767 - 31196689
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
31196767 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 31196689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 31434764 - 31434842
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
31434764 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 31434842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32832394 - 32832316
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
32832394 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt 32832316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37587742 - 37587664
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||    
37587742 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt 37587664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 47433653 - 47433730
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
47433653 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 47433730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 3898403 - 3898324
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
3898403 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 3898324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 11992730 - 11992651
Alignment:
96 atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
11992730 atgaacatgacgttttgcaaataccccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 11992651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 16265461 - 16265540
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
16265461 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 16265540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30751262 - 30751341
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
30751262 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 30751341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 30753073 - 30753152
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
30753073 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 30753152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 51619543 - 51619622
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
51619543 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 51619622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 17273660 - 17273582
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
17273660 tgaacatgacgttttgcaaataccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 17273582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 22775573 - 22775651
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
22775573 tgaacatgacgttttacaaataccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt 22775651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31676385 - 31676307
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||    
31676385 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaacgccccccaaacttaaaaatttatatt 31676307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36304144 - 36304222
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
36304144 tgaacatgacgttttgcaaatatcctttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 36304222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42246898 - 42246820
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
42246898 tgaacatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 42246820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 48803498 - 48803576
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||    
48803498 tgaacatgaagttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgccccccaaacttgaaaatttatat 48803576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 51000991 - 51000913
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||  |||||| ||||||||||||    
51000991 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaacttcaaaatttatatt 51000913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 18053824 - 18053904
Alignment:
97 tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
18053824 tgaacatgacgttttgcaaatacttcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 18053904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 16797272 - 16797351
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||  ||||||||||||||||||||||    
16797272 aacatgacgttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgcccc-taaacttgaaaatttatattttt 16797351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 35156127 - 35156051
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||    
35156127 aacatgacgttttgcaaatatccccatgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttatat 35156051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7436679 - 7436758
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
7436679 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 7436758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7437286 - 7437207
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
7437286 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 7437207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 10386971 - 10387050
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
10386971 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 10387050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 11992121 - 11992200
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
11992121 tgaacatgacgttttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 11992200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13242329 - 13242408
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
13242329 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 13242408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24982779 - 24982858
Alignment:
97 tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
24982779 tgaacatgacgttttgcaaatattcccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 24982858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25227539 - 25227618
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
25227539 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 25227618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26442033 - 26442112
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||| ||||||||||||    
26442033 tgaacatgacgttttgcaaatatccccctgaagtttttcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 26442112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32074663 - 32074584
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||| ||||||    
32074663 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatatatatt 32074584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 35894200 - 35894279
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
35894200 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 35894279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 35894809 - 35894730
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
35894809 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 35894730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37538467 - 37538388
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
37538467 tgaacatgacgttttgcaaatatccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 37538388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37613574 - 37613495
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
37613574 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 37613495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 46804505 - 46804426
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
46804505 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 46804426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 52869795 - 52869870
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| | |||||||||||||||||    
52869795 aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat 52869870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4512737 - 4512814
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||    
4512737 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc-caaacataaaaatttatatt 4512814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 14403971 - 14404049
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||  ||||| |||||||||||||||    
14403971 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccg--aactt-aaaatttatattttt 14404049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 29674430 - 29674508
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||| ||||||| ||||||||||||    
29674430 tgaacatgacgttttgcaaataccccatgaagttttgcacttatgtacaaaatgccccccaaacttaaaaatttatatt 29674508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 37612966 - 37613044
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||    
37612966 tgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatat 37613044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 48803897 - 48803819
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||    
48803897 tgaacatgaagttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 48803819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 52359426 - 52359503
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||| ||||||||||||    
52359426 tgaacatgacgttttgcaaataccccctgaagttttccacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 52359503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4469589 - 4469669
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
4469589 tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 4469669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 6783843 - 6783766
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| |||||||||||    
6783843 tgaacatgaagttttgcaaataccccctgaagttttgcacttatgtgcaaaataccccccaaacttaaaaatttatat 6783766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8384098 - 8384018
Alignment:
97 tgaacatgacgttttgcaaatatcccct--gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
8384098 tgaacatgacgttttgcaaataccccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 8384018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 9061173 - 9061093
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
9061173 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 9061093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 29329425 - 29329506
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||  ||||||| |||||||||||||||    
29329425 tgaacatgatgttttgcaaataccccctgaagttttgcacttatatgcaaaatgccctccaaacttaaaaatttatattttt 29329506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 29358356 - 29358276
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
29358356 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 29358276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37276329 - 37276249
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
37276329 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 37276249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38788549 - 38788469
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
38788549 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 38788469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 43680499 - 43680576
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||  ||||||||||||    
43680499 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaact--aaaatttatatt 43680576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 1799753 - 1799678
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||   |||||||||||||||||    
1799753 aacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttatat 1799678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4632385 - 4632306
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
4632385 tgaacatgactttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 4632306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 10387580 - 10387501
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||| | ||||||||||||    
10387580 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt 10387501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 20898649 - 20898728
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
20898649 tgaacatgacattttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 20898728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 25228149 - 25228070
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||||| ||||||| ||||||||||||    
25228149 tgaacatgacgttttgcaaatacccccctgaagctttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 25228070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 25859579 - 25859500
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||  |||||||||||    
25859579 tgaacatgacgttttacaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaacttacaaatttatatt 25859500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 26615067 - 26615142
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | || |||||| |||||||    
26615067 aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccgaatttgaaattttatat 26615142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 29330031 - 29329953
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
29330031 aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 29329953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 37275719 - 37275798
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
37275719 tgaacacgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 37275798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38456708 - 38456787
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||  ||||||| ||||||||||||    
38456708 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgacctccaaacttaaaaatttatatt 38456787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 40315546 - 40315467
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||   |||||||||||||||||||||    
40315546 aacatgacgttttgcaaataccccgtgaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttatattttt 40315467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41115782 - 41115703
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
41115782 tgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 41115703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 96 - 175
Target Start/End: Original strand, 42246300 - 42246378
Alignment:
96 atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
42246300 atgaacatgacgttttgcaaataccccc-gaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 42246378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 46294574 - 46294653
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||  |||||||||||||||||||||    
46294574 aacataacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatttt 46294653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 46803897 - 46803976
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||| |||||||    
46803897 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaacttatatt 46803976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 47434260 - 47434181
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
47434260 tgaacatgacgttttgcaaatacccccctgaacttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 47434181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 51000102 - 51000178
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||  ||||||| ||||||||||||    
51000102 tgaacatgacgttttgtaaataccccctgaagttttgcacttatgtgcaaaatgccc--caaacttaaaaatttatatt 51000178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13265338 - 13265261
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||| | ||||||||||||    
13265338 tgaacatgacgttttgcaaataccccc-gaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt 13265261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 18611865 - 18611787
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||| |||||||||||    
18611865 tgaacatgaagttttgcaaatatccccctgaagttttgcacttatgtacaaaatgcccctcaaacttaaaaatttatat 18611787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 24250543 - 24250621
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||    
24250543 tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 24250621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 43214607 - 43214688
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| | ||||| |||||||||||||||    
43214607 aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaatttatattttt 43214688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 4514114 - 4514033
Alignment:
96 atgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |||| ||||||| ||||||||||||    
4514114 atgaacatgacgttttgcaaatatccccctgaaattttgcacttatgtgcaaaatgtccccccaaacttaaaaatttatatt 4514033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 31196159 - 31196239
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||| | ||||||||||||    
31196159 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt 31196239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 31675518 - 31675598
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
31675518 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 31675598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38457318 - 38457238
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
38457318 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 38457238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38787667 - 38787747
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| | ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
38787667 tgaacatgacgttttgcaaacaccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 38787747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 45508024 - 45508103
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
45508024 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 45508103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 49204205 - 49204125
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  | ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
49204205 tgaacatgacgttttgcaaataccccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 49204125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 6783263 - 6783339
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| | |||||||||||||||||    
6783263 aacatgacgttttgcaaatactcctctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat 6783339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 32815043 - 32814963
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| ||||| |||||| |||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||    
32815043 aacatgatgtttttcaaatacccccatgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttatattttt 32814963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 43760247 - 43760167
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||| |||||| |||| ||||||||||| ||||||||||||||||||  |||||||||||||||||||||||    
43760247 aacatgacgtttttcaaatacccccctgaagttttgcgcttatgtgcaaaatgccctccaaacttgaaaatttatattttt 43760167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 45141605 - 45141685
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaactt-gaaaatttatattttt 178  Q
    |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||   ||||| ||||||||||||||||    
45141605 aacatgacgttttgcaaataccccctggagttttgcacttatgtgcaaaatgccccctgaacttggaaaatttatattttt 45141685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1024173 - 1024094
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| |||||| |||||||||||||||||||||||| |||| ||||||| ||||||||||||    
1024173 tgaacatgacgttttacaaatactcccctaaagttttgcacttatgtgcaaaattccccccaaacttaaaaatttatatt 1024094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4470199 - 4470120
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| | |||||||||||||||||||||||||||||  |||||| ||||||||||||    
4470199 tgaacatgacgttttgcaaatacccccataaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttatatt 4470120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13242955 - 13242876
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| |||| |||||||||| |||||||||||||||||||| ||||||| ||||||||||||    
13242955 tgaacataacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttatatt 13242876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 13534054 - 13533999
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
13534054 aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgcccc 13533999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 20899257 - 20899179
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||| ||||||| ||||||||||||    
20899257 tgaacatgacgttttgcaaatacccccctgaagttctgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 20899179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 25376867 - 25376946
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| |||||||||||||| |||||||||||||||| |||||||||||||||| |   |||||||||||||||||||||    
25376867 aacatcacgttttgcaaataccccctgaagttttgcaattatgtgcaaaatgcctcttgaacttgaaaatttatattttt 25376946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 161
Target Start/End: Original strand, 29357491 - 29357557
Alignment:
97 tgaacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaact 161  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||| ||||||    
29357491 tgaacatgacgttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgccccccaaact 29357557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 96 - 175
Target Start/End: Original strand, 30634429 - 30634507
Alignment:
96 atgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| || | ||||| ||||||||||||    
30634429 atgaacatgacgttttgtaaataccccctgaagttttgcacttatgtgcaaaatgctcc-cgaacttaaaaatttatatt 30634507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31435479 - 31435400
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||  |||||| ||||||||||||    
31435479 tgaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgctcccaaaacttaaaaatttatatt 31435400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 32831784 - 32831862
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| | ||||||||||    
32831784 tgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgccccccaaactt-agaatttatatt 32831862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 37587133 - 37587212
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | |||| || ||||||||||||    
37587133 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcctcccaaatttaaaaatttatatt 37587212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38834248 - 38834170
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||| |||||| ||||||||||||    
38834248 tgaacatgacgttttgcaaataccccactgaagttttgcacatatgtgcaaaatgccccg-aaacttaaaaatttatatt 38834170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42148507 - 42148585
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
42148507 tgaacataacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 42148585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 44431319 - 44431398
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||  ||||||||||||| ||||||||||||||| ||||   |||||||||||||||||||||    
44431319 aacatgacgttttgcaaatactccctgaagttttgtacttatgtgcaaaataccccatgaacttgaaaatttatattttt 44431398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 1798900 - 1798978
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| ||| |||||||||||||||||||||||||| ||||  ||| |||||||||||||||||    
1798900 aacataacgttttgcaaataccccatgaagttttgcacttatgtgcaaaataccccataaatttgaaaatttatatttt 1798978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 172
Target Start/End: Original strand, 8897054 - 8897128
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    ||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||    
8897054 aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttat 8897128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 12770200 - 12770278
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||    
12770200 tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatat 12770278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 22776140 - 22776063
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| || || ||||||||| ||||||||||||||||||| ||||||| ||||||||||||    
22776140 tgaacatgacgttttgcaaatacccactaaagttttgctcttatgtgcaaaatgcccc-caaacttaaaaatttatatt 22776063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 27234368 - 27234445
Alignment:
98 gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata 173  Q
    ||||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||  |||||| ||||||||||    
27234368 gaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata 27234445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 29675039 - 29674958
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||| |||| ||||||| ||||||||||||    
29675039 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttatatt 29674958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 98 - 173
Target Start/End: Complemental strand, 36305027 - 36304950
Alignment:
98 gaacatgacgttttgcaaatatccc--ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata 173  Q
    ||||||||||||||||| |||||||  ||||||||||||| |||||||||||||||||| ||||||| ||||||||||    
36305027 gaacatgacgttttgcatatatccctcctgaagttttgcatttatgtgcaaaatgccccccaaacttaaaaatttata 36304950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 44432238 - 44432160
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| ||| | |||||||||||||||||| ||||||||||  |||||||||||||||||||||    
44432238 aacataacgttttgcaaataccccataaagttttgcacttatgtgaaaaatgccccctaaacttgaaaatttatatttt 44432160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 48720904 - 48720981
Alignment:
99 aacatgacgttttgcaaatatcc--cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||||  ||||||||||| ||||||||||||||||| ||| | |||||||||||||||||    
48720904 aacatgacgttttgcaaatatccgccctgaagttttacacttatgtgcaaaatgtcccccgaacttgaaaatttatat 48720981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 52870043 - 52870120
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||    
52870043 tgaacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatat 52870120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13149627 - 13149707
Alignment:
97 tgaacatgacgttttgcaaatatccc--ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| ||||||||||||||||| |||  ||||||||||||||||||||||||||||| || ||||||| ||||||||||||    
13149627 tgaatatgacgttttgcaaatacccctcctgaagttttgcacttatgtgcaaaatgcgcctcaaacttaaaaatttatatt 13149707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 16266560 - 16266639
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||  |||| |||||||||||||| ||||||||||||||| ||||||| ||||||||||||    
16266560 tgaacatgacgttttgcaaatatccccccagaagttttgcacttgtgtgcaaaatgcccc-caaacttaaaaatttatatt 16266639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 18054435 - 18054355
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| ||||  |||||||||| |||||||||||||||||||| ||||||| ||||||||||||    
18054435 tgaacatgatgttttgcaaataccccccctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttatatt 18054355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 99 - 172
Target Start/End: Original strand, 18611286 - 18611359
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||| | |||  | |||||||||||||||    
18611286 aacatgacgttttgcaaatatcccctgaagttttacacttatgtgcaaattcccctccgaacttgaaaatttat 18611359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 99 - 164
Target Start/End: Original strand, 27234556 - 27234621
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga 164  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  ||||||||    
27234556 aacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgctccctaaacttga 27234621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 52360290 - 52360210
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| ||||| ||||  ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
52360290 tgaacatgacgttttgaaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 52360210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 16798212 - 16798132
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||| ||||||||| ||||||||||||||||| |||   |||||||||||||||||||||    
16798212 aacatgacgttttgcaaatacccccctgaagtttttcacttatgtgcaaaatgtccccagaacttgaaaatttatattttt 16798132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 23703797 - 23703721
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |   |||||||||||||||||    
23703797 aacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcctcctgaacttgaaaatttatat 23703721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 98 - 173
Target Start/End: Complemental strand, 30753953 - 30753878
Alignment:
98 gaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata 173  Q
    ||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||| ||||||| ||||||||||    
30753953 gaacatgacgttttgcaaatacccgcctgaagttttgcacttatgtgcaaaaggcccc-caaacttaaaaatttata 30753878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 37812488 - 37812568
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaag-ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||| ||  |||||||||||||||||||||||||| ||||||| ||||||||||||    
37812488 tgaacatgacgttttgcaaatactccccttaaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 37812568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #120
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4212921 - 4212999
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||||||||  |||||||||||||||||||||||||||||| ||||||| |||| |||||||    
4212921 tgaacatgatgttttgcaaatatcccccagaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaaattatatt 4212999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #121
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8383486 - 8383567
Alignment:
97 tgaacatgacgttttgcaaatatcccc---tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||   ||||||||||||||||||||||||||| ||  ||||||| ||||||||||||    
8383486 tgaacatgacgttttgcaaatacccccccctgaagttttgcacttatgtgcaaaatgtcctccaaacttcaaaatttatatt 8383567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #122
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 37813098 - 37813020
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||| ||||||||| ||||||| ||||||||||||    
37813098 tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgc-aaatgccccccaaacttaaaaatttatatt 37813020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #123
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38617919 - 38617840
Alignment:
97 tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| ||||||||||||  |||| ||||||||||||||||||||||||| |||| ||||||| ||||||||||||    
38617919 tgaacatgatgttttgcaaatacaccccagaagttttgcacttatgtgcaaaattcccctcaaacttaaaaatttatatt 38617840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #124
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 42233603 - 42233528
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| | | ||||||||||||||||||||||||||||| |   |||||||||||||||||    
42233603 aacatgacgttttgcaaatacctcatgaagttttgcacttatgtgcaaaatgccacctgaacttgaaaatttatat 42233528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #125
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 44396599 - 44396677
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||| ||||||  ||||||||||||    
44396599 tgaacatgacgttttacaaatacccccttgaagttttgcacttatgtgcaaaatgcccc-caaactaaaaaatttatatt 44396677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #126
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 48721479 - 48721400
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgcccc-gcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||||  ||||||| |||||||||||    
48721479 tgaacatgaagttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgcccctccaaacttaaaaatttatat 48721400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #127
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6917277 - 6917355
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||  |||| |||||||||| |||||||||||||||| | | ||||| ||||||||||||    
6917277 tgaacatgacgttttgcaaatactccctaaagttttgcatttatgtgcaaaatgcctcacgaacttaaaaatttatatt 6917355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #128
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 9033724 - 9033782
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
9033724 cccctgaaattttgcacttatgtgcaaaatgccccttaaacttgaaaatttatattttt 9033782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #129
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 153
Target Start/End: Complemental strand, 11202172 - 11202118
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccc 153  Q
    |||||||||||||||||||| |||||||||||||| |||||||||||||||||||    
11202172 aacatgacgttttgcaaataccccctgaagttttgtacttatgtgcaaaatgccc 11202118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #130
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 11707441 - 11707383
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
11707441 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 11707383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #131
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 100 - 175
Target Start/End: Original strand, 20358061 - 20358138
Alignment:
100 acatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||| |||||||||||| ||||  ||||||||||||||||||||||||||||||| |||| || ||||||||||||    
20358061 acatgatgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt 20358138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #132
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 100 - 175
Target Start/End: Complemental strand, 20561894 - 20561817
Alignment:
100 acatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||| |||||||||||| ||||  ||||||||||||||||||||||||||||||| |||| || ||||||||||||    
20561894 acatgatgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt 20561817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #133
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 28296684 - 28296766
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||| ||||| |||||| |||| ||||||||||||||||||||||||||||||  ||||||| ||||||||| |||||    
28296684 tgaacatgaagttttacaaatacccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatgttttt 28296766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #134
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 36723984 - 36723926
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
36723984 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 36723926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #135
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 38623780 - 38623722
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
38623780 cccctgaaattttgcacttatgtgcaaaatgccccttaaacttgaaaatttatattttt 38623722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #136
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 107 - 174
Target Start/End: Complemental strand, 40116910 - 40116841
Alignment:
107 gttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||  |||||||||||||||||||||||||||||||| ||| | |||||||||||||||||    
40116910 gttttgcaaatacctcccctgaagttttgcacttatgtgcaaaatgtccctcgaacttgaaaatttatat 40116841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #137
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 170
Target Start/End: Complemental strand, 44397478 - 44397404
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    ||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||  ||||||| |||||||    
44397478 tgaacataacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaattt 44397404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #138
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 45508632 - 45508550
Alignment:
96 atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaat-gccccgc-aaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||| | |||||| ||||||||||||    
45508632 atgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatcgccccccaaaacttaaaaatttatatt 45508550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #139
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 49203330 - 49203408
Alignment:
98 gaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| ||||||||||||||| |||| |||||||||| ||||||||||||| |||||| ||||||| ||||||||||||    
49203330 gaacaagacgttttgcaaataaccccctgaagttttgtacttatgtgcaaattgccccccaaacttaaaaatttatatt 49203408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #140
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 11184543 - 11184623
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||||||||| || |||||||||||||||||| ||||||||| ||| | | |||||||||||||||||||    
11184543 tgaatatgacgttttgcaaatacccactgaagttttgcacttatatgcaaaatgtccc-cgagcttgaaaatttatattttt 11184623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #141
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 16834500 - 16834577
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| ||||||||||| || |||| | |||||||||||||||||||||||||||||  |||||||||||||||||||    
16834500 aacataacgttttgcaattaccccccttaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatt 16834577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #142
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38833638 - 38833718
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||| |||||||||||||| ||||||||||  |||||| ||||||||||||    
38833638 tgaacatgacgttttgcaaataccccccctgaagatttgcacttatgtgtaaaatgccccctaaactttaaaatttatatt 38833718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #143
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 45217737 - 45217673
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
45217737 caaataccccctgaaattttgcacttatgtgcaaaatgcccc-taaacttgaaaatttatattttt 45217673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #144
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 105 - 174
Target Start/End: Original strand, 50642941 - 50643009
Alignment:
105 acgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||| || ||||||||||||||||||||| |||||||||| ||||||||||||| |||||    
50642941 acgttttgcaaataccctctgaagttttgcacttatgtgtaaaatgcccc-caaacttgaaaatgtatat 50643009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #145
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 8897633 - 8897557
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||| ||||| |||||||| ||||||||||||||||||| | | |||||||||||||||||    
8897633 aacataacgttttgcaaatacccccttgaagttttacacttatgtgcaaaatgcctcccgaacttgaaaatttatat 8897557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #146
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 13698293 - 13698210
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||  |||||||||| ||||  ||||||||| |||||||||||||||||||||   |||||||||||||||||||||    
13698293 tgaacatgacaatttgcaaataccccccctgaagttttccacttatgtgcaaaatgccccatgaacttgaaaatttatattttt 13698210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #147
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 21247499 - 21247423
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||  ||||||||||| |||| |||||||||||||||||||||||||||||||   |||||||||||||||||    
21247499 aacatgatattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccatgaacttgaaaatttatat 21247423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #148
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 28297271 - 28297195
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||| |||||||| || ||||||||||||||||||   |||||||||||||||||    
28297271 aacatgacgttttgcaaatacccccttgaagttttacagttatgtgcaaaatgccccctgaacttgaaaatttatat 28297195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #149
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 31050098 - 31050178
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| ||||| |||||| |||| |||||||||||| |||||||||||||||||| | || ||||||||||||||||||    
31050098 aacatgaagttttacaaatacccccatgaagttttgcatttatgtgcaaaatgccccacgaatttgaaaatttatattttt 31050178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #150
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 32186280 - 32186200
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||  | || |||||||||||| |||||    
32186280 aacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccctccgaatttgaaaatttatgttttt 32186200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #151
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 39364972 - 39365048
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| |||||||||| |||||||||||||||||| |   |||||||||||||||||    
39364972 aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgcctcatgaacttgaaaatttatat 39365048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #152
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4631779 - 4631858
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| ||||| |||| | ||||||||||||||||||||||||| |||  |||||| ||||||||||||    
4631779 tgaacatgacgttttgtaaatacccccctaaagttttgcacttatgtgcaaaatgaccccaaaacttaaaaatttatatt 4631858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #153
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 9055744 - 9055823
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| |||| |||| |||||||||||||||||||||||  | ||||||| ||||||||||||    
9055744 tgaacataacgttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgcttcccaaacttaaaaatttatatt 9055823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #154
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13158793 - 13158715
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| |||| |||||||||||||||| |||||||||||||| |||| || ||||||||||||    
13158793 tgaacatgatgttttgcaaatacccccctgaagttttgcacttacgtgcaaaatgcccc-caaatttaaaaatttatatt 13158715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #155
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21040925 - 21040846
Alignment:
97 tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| | |||| ||||||||||||||||||| ||||||||| ||||||| ||| ||||||||    
21040925 tgaacatgacattttgcaaataccgccctaaagttttgcacttatgtgcgaaatgccccccaaacttaaaattttatatt 21040846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #156
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 102 - 174
Target Start/End: Complemental strand, 26615765 - 26615691
Alignment:
102 atgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||| ||||  |||||||||||||||||| ||||||||||||   |||||||||||||||||    
26615765 atgacgttttgcaaataccccccctgaagttttgcacttatgagcaaaatgccccttgaacttgaaaatttatat 26615691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #157
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 34556954 - 34557029
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||| ||||| |||||||||||||| |||||||||||||||| ||  |||| || |||||||||||    
34556954 aacatgacgttttgtaaataccccctgaagttttgtacttatgtgcaaaatgtccaccaaatttaaaaatttatat 34557029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #158
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42149114 - 42149036
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||| |||  ||||||| |||| |||||||    
42149114 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaat-ccctccaaacttaaaaaattatatt 42149036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #159
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 46585550 - 46585491
Alignment:
119 tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||| ||||||||||||||||||||||||||  |||||| |||||||||||||||    
46585550 tcccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaatttatattttt 46585491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #160
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 48751679 - 48751730
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg 150  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||    
48751679 aacaagacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatg 48751730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #161
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 8742577 - 8742523
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||    
8742577 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat 8742523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #162
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 9034547 - 9034493
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
9034547 tgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 9034493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #163
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 9680965 - 9680907
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||| ||||||||||||||||||||  ||||||||||||||||||||||    
9680965 cccctgaaattttgtacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 9680907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #164
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13697722 - 13697798
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||| ||| | ||||||||||||||||||||||||||||||||| | ||||| ||||||||||||    
13697722 tgaacatgatgttttgcatatacctcctgaagttttgcacttatgtgcaaaatgcccc-cgaactt-aaaatttatatt 13697798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #165
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 173
Target Start/End: Original strand, 29487420 - 29487493
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata 173  Q
    |||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||   |||||||||| |||||    
29487420 aacatgacgttttgcaaataccccct-aagttttgcacttatgtgcaaaatgtcccctgaacttgaaaaattata 29487493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #166
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 35392638 - 35392692
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||    
35392638 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat 35392692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #167
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 37327649 - 37327707
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||||||||| |||||||||    
37327649 cccctgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatctatattttt 37327707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #168
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 43505955 - 43505901
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||    
43505955 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat 43505901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #169
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 32536319 - 32536384
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| |||||| |||||||||||||||||||  ||||||||||||||||| ||||    
32536319 caaataccccctgaaattttgcccttatgtgcaaaatgccccctaaacttgaaaatttatactttt 32536384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #170
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 121 - 174
Target Start/End: Original strand, 35155242 - 35155294
Alignment:
121 ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
35155242 ccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatat 35155294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #171
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 7287677 - 7287753
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||| |||| ||||||||| |||||||||||||||||||||   |||||||| ||||||||    
7287677 aacataacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccctgaacttgaacatttatat 7287753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #172
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 27235129 - 27235053
Alignment:
99 aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||| | |||||||||||||||||||||||||||||||| |   ||||| |||||||||||    
27235129 aacatgacattttgcaaataccaccctgaagttttgcacttatgtgcaaaatgcctcctgaacttaaaaatttatat 27235053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #173
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 43282024 - 43281948
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| |||| ||||||||||||||||||||||||||||  | | ||||| |||||||||||    
43282024 aacatgaagttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcttctcgaacttaaaaatttatat 43281948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #174
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 151
Target Start/End: Complemental strand, 52870621 - 52870569
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc 151  Q
    |||||||||||||||||||| ||||||||||||| || |||||||||||||||    
52870621 aacatgacgttttgcaaataccccctgaagttttacatttatgtgcaaaatgc 52870569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #175
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1023573 - 1023651
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| |||| |||||||||||| |||||||||||| | ||| ||||||| ||||||||||||    
1023573 tgaacatgac-ttttgcaaatacccccctgaagttttgcaattatgtgcaaaaagtccctcaaacttaaaaatttatatt 1023651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #176
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 17826958 - 17826904
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||    
17826958 aacatgacattttgcaaata-cccctgaagttttgtacttatgtgcaaaatgcccc 17826904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #177
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 26189970 - 26189896
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||| ||||| |||||||||| ||||||| |||||||| |||| | ||||| |||||||||||    
26189970 aacatgacgttttgcaattatcctctgaagttttacacttatatgcaaaatacccc-cgaacttaaaaatttatat 26189896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #178
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 175
Target Start/End: Complemental strand, 42128640 - 42128570
Alignment:
104 gacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| | |||||||||||||||||||||||| ||| |||| ||||| | ||||||||||||    
42128640 gacgttttgcaaatacctcctgaagttttgcacttatgtgcagaatacccc-caaacataaaaatttatatt 42128570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #179
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 43215298 - 43215223
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||   |||||| ||| |||||||||  |||||||||||||||||||| ||||||| |||||||||||    
43215298 aacatgacgttagacaaataccccatgaagttttatacttatgtgcaaaatgccccccaaacttaaaaatttatat 43215223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #180
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 45142456 - 45142379
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||| |||||||| || |||||||||||||||||| | |||||||||||| || |||||    
45142456 aacatgacgttttgcaaataccccc-gaagttttacagttatgtgcaaaatgcccc-ctaacttgaaaattcattttttt 45142379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #181
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 163
Target Start/End: Complemental strand, 51547255 - 51547188
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttg 163  Q
    ||||||| ||||||| |||||| |||| ||||||||| ||||||||||||||||||||| ||||||||    
51547255 tgaacataacgttttccaaatacccccctgaagttttacacttatgtgcaaaatgccccccaaacttg 51547188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #182
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 8741884 - 8741942
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
8741884 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 8741942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #183
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 10373695 - 10373749
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| |||||||||||||||||||||||||   ||||||||||||||||||    
10373695 cccctgaaattttgcacttatgtgcaaaatgccctctaaacttgaaaatttatat 10373749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #184
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 22388471 - 22388552
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||||  ||||||||||||||||||||  ||||||  | | ||||| |||||||||||||||    
22388471 aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgttaaatgcttcccgaacttaaaaatttatattttt 22388552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #185
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 27326426 - 27326484
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
27326426 cccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaatttagattttt 27326484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #186
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 27326972 - 27326914
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||||||||  |||||||||    
27326972 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaaaatatattttt 27326914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #187
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 29487941 - 29487860
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||||||| ||||  |||||||||||||||||| ||||||| ||| |  ||||| |||||||||||||||    
29487941 aacaagacgttttgcaaataccccccctgaagttttgcacttatgcgcaaaattccctgtgaacttaaaaatttatattttt 29487860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #188
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 36723442 - 36723500
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
36723442 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 36723500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #189
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 46584915 - 46584973
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||  ||||||||||||||||||    
46584915 cccctgaaattttgcacttatgtgcaaaatgccccctaattttgaaaatttatattttt 46584973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #190
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 49216925 - 49216867
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||   ||||||||||||||| |||||    
49216925 cccctgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaatttatcttttt 49216867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #191
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 114 - 171
Target Start/End: Complemental strand, 15926783 - 15926727
Alignment:
114 aaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    ||||| |||||||| ||||||||||||||||||||||||||  |||||||||||||||    
15926783 aaataccccctgaaattttgcacttatgtgcaaaatgcccc-taaacttgaaaattta 15926727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #192
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 31058641 - 31058563
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||| | ||||||||||||||| |||||||||||||   |||||  ||||||||||||||    
31058641 aacatgacgttttgcaaatacccccataaagttttgcacttatttgcaaaatgccccctgaactt--aaatttatattttt 31058563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #193
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 32537158 - 32537093
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||||||||||||||  ||| || |||||||| ||||||    
32537158 caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaatttaaaaatttagattttt 32537093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #194
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 174
Target Start/End: Complemental strand, 44432745 - 44432684
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||| |||||||| |||||||||||||| |||||||| ||  ||||||||||||||||||    
44432745 caaataccccctgaaattttgcacttatgtccaaaatgctccataaacttgaaaatttatat 44432684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #195
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 102 - 174
Target Start/End: Complemental strand, 7288250 - 7288179
Alignment:
102 atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||| |||||||||||| ||||  |||||||||| ||||||| ||||||||||| |||||| |||||||||||    
7288250 atgaagttttgcaaatacccccctaagttttgcatttatgtgtaaaatgccccg-aaacttaaaaatttatat 7288179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #196
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 166
Target Start/End: Complemental strand, 18807620 - 18807552
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaa 166  Q
    |||||||||||||| ||||| |||| |||||||||||| |||| |||||||||||||  ||||||||||    
18807620 aacatgacgttttgtaaatacccccctgaagttttgcagttatatgcaaaatgccccctaaacttgaaa 18807552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #197
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 21246612 - 21246664
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||||||||||||||||||| |||||| |  ||||||||||||||||||||    
21246612 tgaagttttgcacttatgtgcagaatgcctcataaacttgaaaatttatattt 21246664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #198
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 22389158 - 22389082
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| |||| | |||||||||| ||||||| ||||| |||| | |||||||||||||||||    
22389158 aacatgatgttttgcaaatagccccctaaagttttgcaattatgtgtaaaataccccccgaacttgaaaatttatat 22389082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #199
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 27134429 - 27134481
Alignment:
122 cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||| ||||||||||||||||||||||||||   |||||||||||||||||    
27134429 cctgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaatttatat 27134481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #200
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 32814355 - 32814430
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||  ||||||||||| ||| ||||||||||| |||||||||| ||||||||| ||||||| |||||||||||    
32814355 aacatgatcttttgcaaatacccctctgaagttttgaacttatgtgc-aaatgccccccaaacttaaaaatttatat 32814430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #201
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 44157125 - 44157069
Alignment:
122 cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
44157125 cctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 44157069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #202
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 46295477 - 46295401
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| ||  ||||||||||| ||||||||||||||||||||    ||||||||||||||||    
46295477 aacatgatgttttgcaaatacccatctgaagttttgtacttatgtgcaaaatgccccctggacttgaaaatttatat 46295401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #203
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 175
Target Start/End: Original strand, 10509650 - 10509704
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| || |||||||||||||||||||||||||| ||||||| ||||||||||||    
10509650 cccctaaaattttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 10509704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #204
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 33740887 - 33740836
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| ||||||||||||||||||||||| ||  ||||||||||||||||||    
33740887 ctgaaattttgcacttatgtgcaaaatgctccctaaacttgaaaatttatat 33740836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #205
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 134
Target Start/End: Complemental strand, 38065611 - 38065576
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgc 134  Q
    ||||||||||||||||||||||||||||||||||||    
38065611 aacatgacgttttgcaaatatcccctgaagttttgc 38065576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #206
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42413234 - 42413312
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| ||||||||||||||||| |||| | |||||||||| |||||||||||||||||| | || || ||||||||||||    
42413234 tgaatatgacgttttgcaaatacccccctaaagttttgcatttatgtgcaaaatgcccc-cgaatttaaaaatttatatt 42413312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #207
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 43281312 - 43281366
Alignment:
102 atgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||||||||||||||| ||||  |||||||||||||||||||| ||||||||||    
43281312 atgacgttttgcaaataccccccctgaagttttgcacttatgtgtaaaatgcccc 43281366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #208
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 51597006 - 51596926
Alignment:
99 aacatgacgttttgcaaatat---cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    |||||||||||||||||||||   ||||| ||||||||||||||||| ||||||  ||| | ||||| ||||||||||||||    
51597006 aacatgacgttttgcaaatatccccccctaaagttttgcacttatgttcaaaat-accctcgaacttaaaaatttatatttt 51596926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #209
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6918782 - 6918704
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| ||||| ||||||||||| |  |  ||||||||||||||||||||||||||| | | ||||| ||||||||||||    
6918782 tgaatatgacattttgcaaataccgtccaaagttttgcacttatgtgcaaaatgcctcccgaacttaaaaatttatatt 6918704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #210
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 9680418 - 9680476
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||||||||||||||| |  |||||| |||||||| ||||||    
9680418 cccctgaaattttgcacttatgtgcaaaatgcctcctaaacttaaaaatttagattttt 9680476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #211
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 11706883 - 11706937
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
11706883 tgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 11706937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #212
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 14404511 - 14404434
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| | ||| ||||||||||||| ||||||||||| ||| | ||||  ||||||||||||    
14404511 tgaacatgactttttgcaaatacctcctaaagttttgcacttttgtgcaaaatgtccc-cgaactaaaaaatttatatt 14404434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #213
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 18542238 - 18542162
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||| ||||  ||||||||||||||||| | ||||||||||| | ||||| |||||||||||    
18542238 aacatgacattttgcaaataccccccctgaagttttgcacttatttacaaaatgcccc-cgaacttaaaaatttatat 18542162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #214
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 24480408 - 24480350
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||| |||||||||||||||||||  |||||| |||||||| ||||||    
24480408 cccctgaaattttgcgcttatgtgcaaaatgccccctaaacttaaaaatttagattttt 24480350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #215
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 24482098 - 24482152
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||||||||||||||||||  ||| || |||||||||||    
24482098 cccctgaaattttgcacttatgtgcaaaatgccccctaaatttaaaaatttatat 24482152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #216
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 154
Target Start/End: Complemental strand, 44210017 - 44209983
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||||||||||||||||||    
44210017 cccctgaagttttgcacttatgtgcaaaatgcccc 44209983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #217
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 48731561 - 48731507
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| |||||||||||    |||||||||||||||||    
48731561 cccctgaagttttgcacttatgcgcaaaatgccctctgaacttgaaaatttatat 48731507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #218
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 52580574 - 52580520
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| |||||||||||||||||||||||| |  |||||| |||||||||||    
52580574 cccctgaaattttgcacttatgtgcaaaatgcctcctaaacttaaaaatttatat 52580520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #219
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 151
Target Start/End: Original strand, 17825962 - 17826011
Alignment:
102 atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc 151  Q
    |||||||||||||||||  | |||||||||||||||||||| ||||||||    
17825962 atgacgttttgcaaatactcgctgaagttttgcacttatgtacaaaatgc 17826011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #220
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 43505391 - 43505456
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||| ||||||||||||||||||  || ||| |||||||| ||||||    
43505391 caaataccccctgaaattttgcatttatgtgcaaaatgccccttaagcttaaaaatttagattttt 43505456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #221
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 34557854 - 34557779
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||| ||||| ||| || |||| |||||||||||||||||||| |||  |||||||||||| |||||    
34557854 aacatgacgttttggaaataaccctctaaagtcttgcacttatgtgcaaaatg-cccttaaacttgaaaatatatat 34557779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #222
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 45216911 - 45216967
Alignment:
122 cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||||||| ||||||||| |||  |||||| |||||||||||||||    
45216911 cctgaaattttgcacttatatgcaaaatgtcccctaaacttaaaaatttatattttt 45216967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #223
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 155
Target Start/End: Complemental strand, 10613784 - 10613749
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccg 155  Q
    ||||| ||||||||||||||||||||||||||||||    
10613784 cccctaaagttttgcacttatgtgcaaaatgccccg 10613749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #224
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 23703195 - 23703238
Alignment:
135 acttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||| |||||||  ||||||||||||||||||||||    
23703195 acttatgtgcaacatgccccctaaacttgaaaatttatattttt 23703238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #225
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 142
Target Start/End: Complemental strand, 43594241 - 43594198
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgt 142  Q
    ||||| |||||||||||||| | |||||||||||||||||||||    
43594241 aacatcacgttttgcaaataccgcctgaagttttgcacttatgt 43594198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #226
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 44744560 - 44744505
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||| |||| ||||||||||||||||||| |  ||||| |||||||||||||    
44744560 cccctgaaattttacacttatgtgcaaaatgcctcctaaactagaaaatttatatt 44744505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #227
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 24482922 - 24482864
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||| |||||||||||||||||| ||  |||||| |||||||| ||||||    
24482922 cccctgaaattttacacttatgtgcaaaatgcaccctaaacttaaaaatttagattttt 24482864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #228
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 35393112 - 35393058
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||||||||||||||||||  ||| || |||||||| ||||||    
35393112 tgaaattttgcacttatgtgcaaaatgccccctaaatttaaaaatttagattttt 35393058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #229
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 37328431 - 37328373
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| || ||||||||||||||||||||||||||  |||||| ||| |||| ||||||    
37328431 cccctaaaattttgcacttatgtgcaaaatgccccctaaacttaaaattttagattttt 37328373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #230
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 43281364 - 43281417
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||||||||| ||||| ||| | ||||| |||||||||||    
43281364 cccctgaagttttgcacttatgtgc-aaatggcccccgaacttaaaaatttatat 43281417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #231
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 154
Target Start/End: Original strand, 44209261 - 44209295
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||| ||||||||||||||    
44209261 cccctgaagttttgcacttaagtgcaaaatgcccc 44209295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #232
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 128 - 178
Target Start/End: Complemental strand, 50643563 - 50643514
Alignment:
128 gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||| ||||||||| ||| | |||||||||||||||||||||    
50643563 gttttgcacttatatgcaaaatg-ccctcgaacttgaaaatttatattttt 50643514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #233
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 7875644 - 7875579
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| ||| |||| ||||| | ||||||||||||||||||  |||||| |||||||| ||||||    
7875644 caaataccccttgaaattttgtaattatgtgcaaaatgccccctaaacttaaaaatttagattttt 7875579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #234
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 177
Target Start/End: Complemental strand, 19076332 - 19076275
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    |||| |||||| || ||||||||||||||| ||||  ||||||||| |||||||||||    
19076332 ccccggaagttatgtacttatgtgcaaaattccccctaaacttgaatatttatatttt 19076275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #235
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 177
Target Start/End: Complemental strand, 19124222 - 19124165
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    |||| |||||| || ||||||||||||||| ||||  ||||||||| |||||||||||    
19124222 ccccggaagttatgtacttatgtgcaaaattccccctaaacttgaatatttatatttt 19124165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #236
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 52579792 - 52579857
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||  |||||||||   |||||| |||||||| ||||||    
52579792 caaataccccctgaaattttgcacttatgtagaaaatgcccaataaacttaaaaatttagattttt 52579857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #237
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 38623239 - 38623295
Alignment:
122 cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||||||| || ||||||||||  |||||| |||||||| ||||||    
38623239 cctgaaattttgcacttatatgtaaaatgccccataaacttaaaaatttagattttt 38623295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #238
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 120 - 164
Target Start/End: Original strand, 44156588 - 44156632
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga 164  Q
    |||||| | ||||||||||||||||||||||||||  ||||||||    
44156588 cccctgtaattttgcacttatgtgcaaaatgccccctaaacttga 44156632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #239
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 51546550 - 51546598
Alignment:
105 acgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgcc 152  Q
    |||||||||||||| ||||| ||| ||||||| ||||||||||||||||    
51546550 acgttttgcaaatactccccagaaattttgcatttatgtgcaaaatgcc 51546598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 67; Significance: 2e-29; HSPs: 86)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 11625343 - 11625265
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
11625343 tgaacgtgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 11625265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 23767719 - 23767641
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
23767719 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 23767641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 18739278 - 18739199
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
18739278 tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 18739199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13045749 - 13045827
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||  ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
13045749 tgaacatgacgttttgcaaatgccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 13045827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 1326606 - 1326683
Alignment:
98 gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
1326606 gaacatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 1326683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 748766 - 748845
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||    
748766 tgaacatgacgttttgcaaatactcccctgaagttttgcacttgtgtgcaaaatgccccccaaacttaaaaatttatatt 748845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1060341 - 1060263
Alignment:
97 tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
1060341 tgaacatgacgttttgcaaatattcccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 1060263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 2318432 - 2318353
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
2318432 tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 2318353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8812180 - 8812259
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
8812180 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccacaaacttaaaaatttatatt 8812259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8812811 - 8812732
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
8812811 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccacaaacttaaaaatttatatt 8812732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13209212 - 13209291
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
13209212 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 13209291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13209820 - 13209741
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
13209820 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 13209741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 20856847 - 20856926
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
20856847 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 20856926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 29678933 - 29678854
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
29678933 tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 29678854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 2317825 - 2317902
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||    
2317825 tgaacatgacgttttgcaaataccccctgacgttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 2317902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 5430324 - 5430401
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||    
5430324 tgaacatgacgttttgcaaata-cccctgaagtcttgcacttatgtgcaaaatgccccccaaactttaaaatttatatt 5430401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 8743041 - 8742963
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||    
8743041 tgaacatgacgttttgcaaatacccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 8742963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8748843 - 8748921
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
8748843 tgaatatgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 8748921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17994190 - 17994268
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  |||||| ||||||||||||    
17994190 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgctcccaaaacttaaaaatttatatt 17994268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 170
Target Start/End: Complemental strand, 24111006 - 24110933
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||  ||||||| |||||||    
24111006 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaattt 24110933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 15145910 - 15145990
Alignment:
97 tgaacatgacgttttgcaaata-tccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
15145910 tgaacatgacgttttgcaaatactccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 15145990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 20857455 - 20857372
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||| ||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||    
20857455 tgaacatgacgtattgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt 20857372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 23075298 - 23075218
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||   |||||||||||||||||||||    
23075298 aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatattttt 23075218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 5417593 - 5417672
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
5417593 tgaacatgacattttgcaaataccccgctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 5417672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23066772 - 23066851
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
23066772 tgaacatgacgttttacaaatatccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 23066851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26609832 - 26609911
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
26609832 tgaacatgacattttgcaaataccctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 26609911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 26610399 - 26610320
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||  |||||| ||||||||||||    
26610399 tgaacatgccgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt 26610320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1059734 - 1059814
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| |||| || ||||||||||||    
1059734 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt 1059814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1327204 - 1327125
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
1327204 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 1327125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 22821267 - 22821347
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
22821267 tgaacattacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 22821347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 28537658 - 28537738
Alignment:
99 aacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| ||||||||||||||   |||||||||||||||||||||||||||||||||||  |||||||||||||||||||||    
28537658 aacataacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccctaaacttgaaaatttatatttt 28537738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 169
Target Start/End: Complemental strand, 32628626 - 32628553
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt 169  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||    
32628626 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatt 32628553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 100 - 175
Target Start/End: Original strand, 15127152 - 15127228
Alignment:
100 acatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||| ||||||| ||||||||||||    
15127152 acatgacgttttgcaaatacccctctgaagttttgcacttatgtggaaaatgccccccaaacttaaaaatttatatt 15127228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 23767090 - 23767172
Alignment:
97 tgaacatgacgttttgcaaata---tcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||   ||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
23767090 tgaacatgacgttttgcaaatactttccccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 23767172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1155352 - 1155274
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||| ||||||| ||||||||||||    
1155352 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatatgcaaaatgcccc-caaacttaaaaatttatatt 1155274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 15146520 - 15146441
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||| |||||||||||||| ||||| | ||||||||||||    
15146520 tgaacatgacgttttgcaaatacccccctgaagttttgcacttacgtgcaaaatgccccccaaacataaaaatttatatt 15146441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 15968636 - 15968715
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||| || | ||||||| ||||||||||||    
15968636 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaattccgcccaaacttaaaaatttatatt 15968715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25404211 - 25404290
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||  |||||| ||||||||||||    
25404211 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccctaaacttaaaaatttatatt 25404290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 102 - 175
Target Start/End: Complemental strand, 11158745 - 11158671
Alignment:
102 atgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||| || ||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
11158745 atgacgttttgcaaataccctcctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 11158671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 22504359 - 22504436
Alignment:
98 gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttata 173  Q
    ||||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||  |||||| ||||||||||    
22504359 gaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttata 22504436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 170
Target Start/End: Complemental strand, 25404822 - 25404749
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |||||||    
25404822 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaattt 25404749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 749367 - 749287
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| ||||  |||||||||||||||||||||||||||||||  |||||| ||||||||||||    
749367 tgaacatgacgttttacaaataccccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt 749287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1050844 - 1050764
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  |||||||||||| |||||||||||||||| | ||||||| ||||||||||||    
1050844 tgaacatgacgttttgcaaataccccccttgaagttttgcatttatgtgcaaaatgcctcccaaacttaaaaatttatatt 1050764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 29678323 - 29678403
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||| ||| ||||    
29678323 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaattttttatt 29678403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 34657940 - 34658016
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| ||||||||| |||||||||| |||||||||| | |||||||||||||||||    
34657940 aacatgacgttttgcaaatacccccctgaagttttacacttatgtggaaaatgccccccgaacttgaaaatttatat 34658016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8939938 - 8940017
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||| |||||||||| |||||||||||||||||| ||||||  |||| |||||||    
8939938 tgaacatgacgttttgcaaatactcccctaaagttttgcatttatgtgcaaaatgccccccaaactaaaaaaattatatt 8940017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 101 - 175
Target Start/End: Original strand, 11624739 - 11624814
Alignment:
101 catgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||  |||||| ||||||||||||    
11624739 catgacgttttgcaaataccccactgaagttttgcactcatgtgcaaaatgcccccaaaacttaaaaatttatatt 11624814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 25163618 - 25163705
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc-----gcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||      ||||||| |||||||||||||||    
25163618 tgaacatgacgttttgcaaatatccccctgaagttttgcacgtatgtgcaaaatgcccccccctccaaacttaaaaatttatattttt 25163705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 16894570 - 16894628
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
16894570 cccctgaaattttgcacttatgtgcaaaatgccccataaacttgaaaatttatattttt 16894628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 22822149 - 22822069
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  |||||||||||| ||||||| |||||||||| ||||||| |||||| |||||    
22822149 tgaacatgacgttttgcaaataccccccctgaagttttgcagttatgtgaaaaatgccccccaaacttaaaaattgatatt 22822069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 10624593 - 10624673
Alignment:
99 aacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| |||||||||||| | |||||||||||||||||||| |||||||| |||| | ||||| |||||||||||||||    
10624593 aacatgatgttttgcaaataccaccctgaagttttgcacttatatgcaaaattcccctcgaacttaaaaatttatattttt 10624673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 14394807 - 14394866
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||    
14394807 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc 14394866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 97 - 148
Target Start/End: Complemental strand, 22504944 - 22504892
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaa 148  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||    
22504944 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaa 22504892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 170
Target Start/End: Complemental strand, 32155281 - 32155209
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    ||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| | ||||| |||||||    
32155281 aacatcacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccgaacttaaaaattt 32155209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 6138329 - 6138250
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||| |||||| |  |||||||||||||||||||||||||||||| |   ||||| |||||||||||||||    
6138329 aacatgacgttttacaaataccatctgaagttttgcacttatgtgcaaaatgcctcatgaacttaaaaatttatattttt 6138250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 11099065 - 11099144
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| |||| |||||||||| |||||| ||||||||| |||  |||||||||||||||||||||    
11099065 aacataacgttttgcaaatacccccctgaagttttgtacttatttgcaaaatgtcccctaaacttgaaaatttatatttt 11099144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 11099944 - 11099869
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||||| |||||| ||||||||| |||||| |||   |||||||||||||||||    
11099944 aacatgacgttttgcaaataccccctgatgttttgtacttatgtgtaaaatgtcccctgaacttgaaaatttatat 11099869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 120 - 175
Target Start/End: Original strand, 24110431 - 24110486
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||||    
24110431 cccctgaagttttgcacttatttgcaaaatgccccccaaacttaaaaatttatatt 24110486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 5400814 - 5400731
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttat----gtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| || |||||||||||| ||||||    |||||||||||||| ||||||| ||||||||||||    
5400814 tgaacatgacgttttgcaaatacccacctgaagttttgtacttatatatgtgcaaaatgccccccaaacttaaaaatttatatt 5400731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 15191945 - 15192003
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||| ||||||    
15191945 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttaaattttt 15192003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 15468606 - 15468548
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||| ||||||    
15468606 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttaaattttt 15468548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1049976 - 1050056
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| ||||  ||||||||||||||||||||| ||||| ||| | ||||| ||||||||||||    
1049976 tgaacatgatgttttgcaaataccccccctgaagttttgcacttatgtgccaaatgtcccccgaacttaaaaatttatatt 1050056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 11640972 - 11641037
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
11640972 caaataccccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt 11641037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 16895123 - 16895058
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
16895123 caaataccccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt 16895058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 1798662 - 1798729
Alignment:
113 caaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||  |||| ||||||||||||||||||||||||||  |||||| |||||||||||||||    
1798662 caaatatcccccttgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttatattttt 1798729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 143
Target Start/End: Complemental strand, 15127667 - 15127620
Alignment:
97 tgaacatgacgttttgcaaatat-cccctgaagttttgcacttatgtg 143  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||    
15127667 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtg 15127620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 29724054 - 29723995
Alignment:
119 tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
29724054 tcccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 29723995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 127 - 174
Target Start/End: Complemental strand, 34658490 - 34658443
Alignment:
127 agttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||||||||| ||||||| |||||||||||    
34658490 agttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 34658443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 1563954 - 1563873
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||| ||||||||||  | | |||||||||||||||||||| || |||   |||||||||||||||||||||    
1563954 aacatgacgttttgtaaatatcccccttaacgttttgcacttatgtgcaaagtgtcccttgaacttgaaaatttatattttt 1563873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 23074434 - 23074515
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||| ||||  |||||||||||| ||||||||||||||||||  |||||| |||||| || |||||    
23074434 aacatgacattttgcaaataccccccctgaagttttgcatttatgtgcaaaatgccccctaaacttaaaaattcattttttt 23074515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 18738453 - 18738527
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| |||||||||||||||||  ||   ||||||| ||| ||||||| ||||||||||||    
18738453 aacatgacgttttgcaaataccccctgaagttttgcac--ataaacaaaatgtcccccaaacttaaaaatttatatt 18738527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 99 - 152
Target Start/End: Original strand, 32154608 - 32154661
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcc 152  Q
    |||||||  ||||||||| | |||||||||||||||||||||||||||||||||    
32154608 aacatgatattttgcaaacaccccctgaagttttgcacttatgtgcaaaatgcc 32154661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 11957110 - 11957190
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||| |||||||| |||| ||||||| ||||||||||| ||||| |||||   ||||| |||||||||||||||    
11957110 aacatgacgttatgcaaatacccccctgaagttgtgcacttatgtacaaaaggccccctgaacttcaaaatttatattttt 11957190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 26583136 - 26583082
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| |||||||||||||||||||||||||   ||||||||| ||||||||    
26583136 cccctgaaattttgcacttatgtgcaaaatgccctctaaacttgaacatttatat 26583082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 28538246 - 28538193
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatg 150  Q
    |||||||||||||||||||| ||||  |||||||||| ||||||||||||||||    
28538246 aacatgacgttttgcaaataccccccctgaagttttgtacttatgtgcaaaatg 28538193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 166
Target Start/End: Original strand, 29212912 - 29212958
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaa 166  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||    
29212912 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaa 29212958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 137 - 178
Target Start/End: Original strand, 8589824 - 8589865
Alignment:
137 ttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||  ||||||||||||||||||||||    
8589824 ttatgtgcaaaatgccccataaacttgaaaatttatattttt 8589865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 129 - 174
Target Start/End: Complemental strand, 32597155 - 32597110
Alignment:
129 ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||||||| ||  ||||||||||||||||||    
32597155 ttttgcacttatgtgcaaaatgctccttaaacttgaaaatttatat 32597110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 162
Target Start/End: Original strand, 14608188 - 14608252
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaactt 162  Q
    |||||||||||||||||||| |||| | |||||||| ||||| |||||||||||| | |||||||    
14608188 aacatgacgttttgcaaataccccccttaagttttgtacttacgtgcaaaatgccgctcaaactt 14608252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 1563032 - 1563110
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||| ||||||| ||||||||||| ||||||||||| ||||||  |||   ||||| ||||||||| |||||    
1563032 aacatgacgttt-gcaaataccccctgaagttatgcacttatgtacaaaatatcccctgaacttaaaaatttatgttttt 1563110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 171
Target Start/End: Original strand, 32596473 - 32596524
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    |||||||| |||||||||||||||||||||| |||  |||||| ||||||||    
32596473 cccctgaaattttgcacttatgtgcaaaatgtcccctaaacttaaaaattta 32596524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 8590630 - 8590580
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||| |||||||||||||||||||||||||    |||||||||||||||||    
8590630 tgaaattttgcacttatgtgcaaaatgcccgctgaacttgaaaatttatat 8590580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 15468059 - 15468117
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||| |||||| |||||||||||||  |||||| |||||||| ||||||    
15468059 cccctgaaattttggacttatatgcaaaatgccccataaacttaaaaatttagattttt 15468117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 137 - 175
Target Start/End: Complemental strand, 17994757 - 17994719
Alignment:
137 ttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||| ||||||| ||||||||||||    
17994757 ttatgtgcaaaatgccccccaaacttaaaaatttatatt 17994719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 29723224 - 29723290
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaa-atttatattttt 178  Q
    |||||| |||| ||| |||||||||||||| |||||||||||  |||||| ||| ||||||||||||    
29723224 caaataccccccgaaattttgcacttatgtacaaaatgccccctaaactttaaatatttatattttt 29723290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 140
Target Start/End: Original strand, 23597171 - 23597204
Alignment:
107 gttttgcaaatatcccctgaagttttgcacttat 140  Q
    ||||||||||||||||||||||||||| ||||||    
23597171 gttttgcaaatatcccctgaagttttgtacttat 23597204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 67; Significance: 2e-29; HSPs: 211)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4153165 - 4153088
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
4153165 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 4153088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6680625 - 6680703
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
6680625 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 6680703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 25338868 - 25338790
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
25338868 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 25338790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 29373959 - 29373881
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
29373959 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 29373881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38395516 - 38395594
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
38395516 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 38395594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7482368 - 7482447
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
7482368 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 7482447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 16048514 - 16048593
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
16048514 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 16048593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 100 - 175
Target Start/End: Complemental strand, 16869210 - 16869135
Alignment:
100 acatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
16869210 acatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 16869135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 22613571 - 22613492
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
22613571 tgaacatgacgttttgcaaatatccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 22613492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 1829535 - 1829613
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||  |||||| ||||||||||||    
1829535 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt 1829613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 11445194 - 11445272
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
11445194 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccacccaaacttaaaaatttatatt 11445272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 171
Target Start/End: Complemental strand, 12404310 - 12404236
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||    
12404310 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaattta 12404236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 32273101 - 32273023
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||| ||||||||||||    
32273101 tgaacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt 32273023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40315002 - 40315080
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||  |||||| ||||||||||||    
40315002 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt 40315080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 8407516 - 8407593
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
8407516 tgaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 8407593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 36778325 - 36778406
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| |||||||| |||||||||||| ||||||||| ||| |||||||||||||||||||||||    
36778325 tgaacatgacgttttgcaaataccccctgaatttttgcacttatatgcaaaatgtccctcaaacttgaaaatttatattttt 36778406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 41411931 - 41412008
Alignment:
98 gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
41411931 gaacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 41412008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 6845076 - 6845159
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||    
6845076 tgaacatgacgttttgcaaatacaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatattttt 6845159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 459604 - 459683
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
459604 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 459683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 2061326 - 2061247
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
2061326 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 2061247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 3508185 - 3508264
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
3508185 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 3508264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 3508794 - 3508715
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
3508794 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 3508715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4152558 - 4152637
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
4152558 tgaacatgacgttttgcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 4152637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4844404 - 4844325
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
4844404 tgaacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt 4844325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6166621 - 6166542
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
6166621 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt 6166542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 6915401 - 6915322
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||   |||||||||||| ||||||||    
6915401 aacatgacgttttgcaaataacccctgaagttttgcacttatgtgcaaaatgccccctgaacttgaaaattaatattttt 6915322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 8160070 - 8160149
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
8160070 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 8160149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8160676 - 8160597
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
8160676 tgaacatgacgttttgcaaataaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 8160597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 12403694 - 12403773
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
12403694 tgaacatgacgttttgcaaatagccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 12403773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 12737019 - 12736940
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
12737019 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 12736940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 12799234 - 12799313
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
12799234 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 12799313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 12799842 - 12799763
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
12799842 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 12799763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13307070 - 13306991
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
13307070 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 13306991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 26395523 - 26395602
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
26395523 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 26395602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38483663 - 38483584
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
38483663 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 38483584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39406193 - 39406272
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||  ||||||| ||||||||||||    
39406193 tgaacatgacgttttgcaaatatccctctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt 39406272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 40195963 - 40195884
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
40195963 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 40195884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42437889 - 42437968
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
42437889 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 42437968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4843796 - 4843874
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| | |||||||||||| |||||||||||||||||||| ||||||| ||||||||||||    
4843796 tgaacatgacgttttgcaaatacctcctgaagttttgtacttatgtgcaaaatgccccccaaacttaaaaatttatatt 4843874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 16353036 - 16353114
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||  ||||||||||||    
16353036 tgaatatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaactaaaaaatttatatt 16353114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38465234 - 38465312
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||  |||||| ||||||||||||    
38465234 tgaacatgacgttttgcaaatacccactgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaatttatatt 38465312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41412537 - 41412459
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||  |||||| |||| |||||||    
41412537 tgaacatgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccctaaacttaaaaaattatatt 41412459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 1830141 - 1830064
Alignment:
98 gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
1830141 gaacatgacattttgcaaataccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 1830064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 9772365 - 9772445
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
9772365 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 9772445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 11445803 - 11445723
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
11445803 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 11445723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 25482589 - 25482509
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
25482589 tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 25482509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 29373354 - 29373430
Alignment:
99 aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
29373354 aacatgacgttttgcaaatattcccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 29373430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 40195362 - 40195442
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
40195362 tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgcccctcaaacttaaaaatttatatt 40195442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 40315608 - 40315531
Alignment:
98 gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
40315608 gaacatgacattttgcaaataccccctgaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 40315531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 11277474 - 11277394
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||  |||||||||||||||||||||||    
11277474 aacatcacgttttgcaaatactcccctgaagttttgcgcttatgtgcaaaatgccctccaaacttgaaaatttatattttt 11277394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 100 - 175
Target Start/End: Original strand, 12366625 - 12366701
Alignment:
100 acatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
12366625 acatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 12366701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 970538 - 970616
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
970538 tgaacatgacgttttgcaaatatcctcatgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 970616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 2060716 - 2060795
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
2060716 tgaacatgacgtttttcaaatacccccttgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 2060795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4299665 - 4299587
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||    
4299665 tgaacatgacgttttgcaaatatccacctgaagttttgcacttatgtgcaaaatgcccc-caagcttaaaaatttatatt 4299587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4912533 - 4912454
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
4912533 tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 4912454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 5576482 - 5576561
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||||||||||||||| ||||||||||||||||||  ||||||||||||| || |||||    
5576482 aacatgacgttttgcaaataccccctgaagttttgcagttatgtgcaaaatgccccctaaacttgaaaattcattttttt 5576561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7482967 - 7482888
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
7482967 tgaacatgatgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 7482888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 9475314 - 9475392
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
9475314 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 9475392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 9475919 - 9475840
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| ||||||| ||||||||||||    
9475919 tgaacatgacgttttgcaaatacccccttgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt 9475840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 12367230 - 12367151
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||||||||||||||| |||||||||||||| ||||||| ||||||||||||    
12367230 tgaacatgacgttttgcaaatacccccctgaagttttgcacttacgtgcaaaatgccccccaaacttaaaaatttatatt 12367151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 12736410 - 12736489
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
12736410 tgaacatgacgttttgcaaataccccccagaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 12736489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 13306467 - 13306546
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| ||||||| ||||||||||||    
13306467 tgaacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt 13306546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 16868588 - 16868667
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
16868588 tgaagatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 16868667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17526191 - 17526270
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||| ||||||| ||||||||||||    
17526191 tgaacatgacgttttgcaaatacccccctgaagttctgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 17526270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 18146412 - 18146334
Alignment:
97 tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
18146412 tgaacatgacgttttgcaaatacctccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 18146334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 25481979 - 25482058
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||| ||||||| ||||||||||||    
25481979 tgaacatgacgttttgcaaataccccctaaagttttgcacttatgtgcaaaatgcccccccaaacttaaaaatttatatt 25482058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 27188700 - 27188626
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||    
27188700 aacatgatgttttgcaaatatcctctgaagttttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttatat 27188626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 32272494 - 32272573
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
32272494 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 32272573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 36810944 - 36811023
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| | || ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
36810944 tgaacatgacgttttgcaaatacctccatgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 36811023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38144010 - 38143931
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||||| ||||||| ||||||||||||    
38144010 tgaacatgacgttttgcaaatatccccatgaagttttgagcttatgtgcaaaatgccccccaaacttaaaaatttatatt 38143931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 39760703 - 39760782
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
39760703 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 39760782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 39761313 - 39761234
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||| ||||||||||||    
39761313 tgaacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 39761234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 41085308 - 41085233
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| ||||||||||||| ||||||||| ||||||||||| |||||||||||||||||||    
41085308 aacatgatgttttgcaaataccccctgaagttttacacttatgtacaaaatgccccccaaacttgaaaatttatat 41085233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 172
Target Start/End: Complemental strand, 460218 - 460141
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttat 172  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| |||||||||    
460218 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttat 460141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 1144355 - 1144278
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||||||  ||||||||| ||||||||||||||||||||| | |||||||||||||||||    
1144355 aacatgacgttttgcaaatatcccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat 1144278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 6166017 - 6166093
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||||||    
6166017 tgaacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgctcc-caaacttaaaaatttatatt 6166093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 6809453 - 6809372
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||   |||||||||||||||||||||    
6809453 aacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaaatttatattttt 6809372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8408127 - 8408050
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||    
8408127 tgaacatgacgttt-gcaaataccccctgaagttttgcgcttatgtgcaaaatgccccccaaacttaaaaatttatatt 8408050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 36779170 - 36779092
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||| || ||||||||| |||||||||||||||| ||||||| ||||||||||||    
36779170 tgaacatgacgttttgcaaataccccctaaaattttgcactgatgtgcaaaatgccccccaaacttaaaaatttatatt 36779092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 36811538 - 36811456
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||  ||| ||||||| |||||||||||||||    
36811538 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatttcccccaaacttaaaaatttatattttt 36811456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 4911923 - 4912003
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
4911923 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcctcccaaacttaaaaatttatatt 4912003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17085936 - 17086016
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| |||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
17085936 tgaacttgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 17086016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 19289863 - 19289783
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||| ||||||||    
19289863 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaactttatatt 19289783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21632399 - 21632319
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| ||||||||||||||   ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
21632399 tgaacattacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 21632319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 21640646 - 21640566
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| ||||||||||||||   ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
21640646 tgaacattacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 21640566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 26396132 - 26396053
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||| ||||||| ||||| ||||||    
26396132 tgaacatgacgttttgcaaatatcccccctgaagttttgcacttatgtgcaaaatgccccccaaactt-aaaatatatatt 26396053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38465810 - 38465730
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||  ||||||| ||||||||||||    
38465810 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccctccaaacttaaaaatttatatt 38465730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 1143777 - 1143856
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| |||||||||||    
1143777 tgaacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 1143856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 4104060 - 4104138
Alignment:
98 gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
4104060 gaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 4104138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 5577346 - 5577266
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||   ||| |||||||||||||||||    
5577346 aacatgacgttttgcaaatactcccctgaacttttgcacttatgtgcaaaatgccccctgaacatgaaaatttatattttt 5577266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 6845686 - 6845607
Alignment:
98 gaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||| ||||  ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
6845686 gaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 6845607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 38424929 - 38424853
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||   |||||||||||||||||    
38424929 aacatgatgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccatgaacttgaaaatttatat 38424853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 41210209 - 41210130
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||| |||||||||||    
41210209 tgaacatgaagttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatat 41210130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 17526800 - 17526721
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| || |||||||||||||||||||||||||||||| || ||||||| ||||||||||||    
17526800 tgaacatgacattttgcaaataccctcctgaagttttgcacttatgtgcaaaatgctccccaaacttaaaaatttatatt 17526721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 19289253 - 19289332
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||  |||||| ||||||||||||    
19289253 tgaacatgacattttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttatatt 19289332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 38186562 - 38186641
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||  ||||||||||||||||||||||||||||| ||||| | ||||||||||||    
38186562 tgaacatgacgttttgcaaatactccccaaaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt 38186641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38211795 - 38211716
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||  ||||||||||||||||||||||||||||| ||||| | ||||||||||||    
38211795 tgaacatgacgttttgcaaatactccccaaaagttttgcacttatgtgcaaaatgccccccaaacataaaaatttatatt 38211716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 38977695 - 38977774
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||   ||||||||| ||| |||||||    
38977695 aacatgacattttgcaaataccccctgaagttttgcacttatgtgcaaaatgccccttgaacttgaaattttttattttt 38977774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 41209630 - 41209704
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| ||||||||||||| |||||||||||||||| |||| | |||||||||||||||||    
41209630 aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatacccc-cgaacttgaaaatttatat 41209704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 4104935 - 4104857
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| |||||| ||||||||||||||||||||| ||||| ||||||  ||||||| ||||||||||||    
4104935 tgaacatgacgttttacaaataccccctgaagttttgcacttatctgcaagatgccctccaaacttaaaaatttatatt 4104857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 7951451 - 7951375
Alignment:
99 aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||| ||||||  |||||||||||||||||||||||||||||||||||| | |||||||||||||||||    
7951451 aacatgacgttttccaaatacctcccctgaagttttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttatat 7951375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 9772973 - 9772895
Alignment:
98 gaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||| | || |||||||||| |||||||||||||||||||||| ||||||| ||||||||||||    
9772973 gaacatgacgttttgcaaacaccctcctgaagtttggcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 9772895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 15180585 - 15180662
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||  |||||| |||||||||||    
15180585 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-aaaacttaaaaatttatat 15180662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 18145807 - 18145884
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||| ||||||||||||| |||| ||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
18145807 tgaacatgtcgttttgcaaataccccc-gaaattttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 18145884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 99 - 169
Target Start/End: Original strand, 19292364 - 19292434
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt 169  Q
    |||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||  |||||||||||||    
19292364 aacatgacgttttgcaaataccccccgaagttttgcagttatgtgcaaaatgccccctaaacttgaaaatt 19292434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 25338258 - 25338316
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
25338258 tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgcccc 25338316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 6681234 - 6681155
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| | ||||  ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
6681234 tgaacatgacgttttgcaaacaccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 6681155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 25823708 - 25823631
Alignment:
98 gaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| |||||||||| |||||||||||||||||||||||||||||||| || | ||| | ||||||||||||    
25823708 gaacatgacgctttgcaaataccccctgaagttttgcacttatgtgcaaaatgcgccccgaacctaaaaatttatatt 25823631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 38396119 - 38396039
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  |||||||||||||||||||| |||||||||  ||||||| ||||||||||||    
38396119 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgaaaaatgccctccaaacttaaaaatttatatt 38396039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 42341261 - 42341341
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| ||||||| ||||||   ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
42341261 tgaacataacgttttacaaatacaccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 42341341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 3307269 - 3307193
Alignment:
99 aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| || |||||||||||| ||||||||||||||||||||||||||||||||||| | ||||| |||||||||||    
3307269 aacataacattttgcaaatatgcccctgaagttttgcacttatgtgcaaaatgccccccgaactttaaaatttatat 3307193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 17647420 - 17647496
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| | |||||||||||||||||||||||||||||   |||||||||||||||||    
17647420 aacatgacgttttgcaaatacccccctaaagttttgcacttatgtgcaaaatgccccctgaacttgaaaatttatat 17647496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 20730997 - 20731069
Alignment:
102 atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||| |||| ||||||||||||||||||||||||||||||    ||||||||||||||||    
20730997 atgacgttttgcaaataccccccgaagttttgcacttatgtgcaaaatgccccttgcacttgaaaatttatat 20731069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 27257156 - 27257231
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||| ||||||||||||| ||||||||||||||||||| | |||| || ||||||||||||    
27257156 aacatgacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgcctc-caaatttaaaaatttatatt 27257231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 5575015 - 5574936
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||| ||||||| ||||| |||||||||||||||| |||||||||||||  |||||||||||||||||||||    
5575015 aacataacgtttggcaaatacccccttgaagttttgcacttatatgcaaaatgccccataaacttgaaaatttatatttt 5574936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 14197963 - 14197884
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||| ||||| ||| ||| ||||||||||||| |||||||||||||   |||||||||||||||||||||    
14197963 aacatgacgttttgtaaataccccatgatgttttgcacttatatgcaaaatgccccttgaacttgaaaatttatattttt 14197884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 101 - 175
Target Start/End: Complemental strand, 15181190 - 15181115
Alignment:
101 catgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||  ||||||||||  |||||||||||||||||||||||||||||| ||||||| ||||||||||||    
15181190 catgacgttttttaaatatccccccgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 15181115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24324477 - 24324555
Alignment:
97 tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||| |||| | ||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||    
24324477 tgaacatgacgttttgcgaatacctccctgaagttttggacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 24324555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 24361101 - 24361179
Alignment:
97 tgaacatgacgttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||| |||| | ||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||    
24361101 tgaacatgacgttttgcgaatacctccctgaagttttggacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 24361179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24361709 - 24361630
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||| |||| ||||||||||||||||||||| ||||||| ||||||| ||||    
24361709 tgaacatgacgttttgcaaatacccccctgaaattttacacttatgtgcaaaatgccccccaaacttaaaaatttgtatt 24361630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 27341984 - 27341902
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaa-atttatattttt 178  Q
    ||||||| |||||||||||||||||  ||||||||||||||||||||||||||||||| | |||||||||  |||||||||||    
27341984 aacatgatgttttgcaaatatcccccttgaagttttgcacttatgtgcaaaatgccccccgaacttgaaatttttatattttt 27341902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42341868 - 42341790
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| ||||| |||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
42341868 tgaacgtgacgatttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 42341790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 11157082 - 11157163
Alignment:
99 aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| ||||||||||||  ||||||||||||||||||||||||| |||||||| | |||||| ||||||| ||||||||    
11157082 aacatgaagttttgcaaatacctcccctgaagttttgcacttatgtggaaaatgcctcccaaactcgaaaattcatattttt 11157163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 29235610 - 29235668
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
29235610 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 29235668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 38978394 - 38978317
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||||||||||||| ||||  ||||||||||||||||||||||||||||||| | ||||| |||||||||||    
38978394 aacataacgttttgcaaataccccccttgaagttttgcacttatgtgcaaaatgccccccgaactttaaaatttatat 38978317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 42438532 - 42438455
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||  |||| ||||||||||||||||||||||| || ||||||| ||||||||||||    
42438532 tgaacatgacgttttgcaaata-cctttgaaattttgcacttatgtgcaaaatgctccccaaacttaaaaatttatatt 42438455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #127
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 6865342 - 6865265
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||  |||| |||||||||||||||||||||||||||||   |||||| ||||||||||||    
6865342 aacatgacgttttgcaaatacgcccttgaagttttgcacttatgtgcaaaatgccctctaaacttaaaaatttatatt 6865265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #128
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 164
Target Start/End: Complemental strand, 11157982 - 11157917
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga 164  Q
    ||||||| |||||||||||| ||||||||||||||||||||||||||||||| ||| | |||||||    
11157982 aacatgaagttttgcaaataccccctgaagttttgcacttatgtgcaaaatgtcccccgaacttga 11157917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #129
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 43067665 - 43067718
Alignment:
122 cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
43067665 cctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 43067718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #130
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 5790487 - 5790431
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||    
5790487 aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc 5790431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #131
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 8505979 - 8505903
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| |||||||||| |||||||||||||||||||    |||||||||||||||||    
8505979 aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgccctctgaacttgaaaatttatat 8505903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #132
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 26359830 - 26359754
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| |||||||||| ||| ||||||||||||||||   |||||||||||||||||    
26359830 aacatgacgttttgcaaatacccccctgaagttttgtactcatgtgcaaaatgccccatgaacttgaaaatttatat 26359754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #133
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 170
Target Start/End: Original strand, 27341299 - 27341371
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    ||||| |||||||||||||||||||| |||||||||||||||||||||||||||||  | ||||| |||||||    
27341299 aacatcacgttttgcaaatatccccttgaagttttgcacttatgtgcaaaatgccctccgaacttaaaaattt 27341371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #134
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 6808467 - 6808545
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||||||| |||| ||||||||||||||||||  | ||||||| ||| |||||||||||    
6808467 aacatgacgttttgcaaata-cccctgaaattttccacttatgtgcaaaatgcttcccaaacttaaaagtttatattttt 6808545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #135
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 6835344 - 6835269
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||| ||||| ||| ||||||||||||||||||||||||||||||| | || || |||||||||||    
6835344 aacatgatgttttgaaaataccccttgaagttttgcacttatgtgcaaaatgcccctcgaatttaaaaatttatat 6835269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #136
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 100 - 174
Target Start/End: Complemental strand, 13545387 - 13545310
Alignment:
100 acatgacgttttgcaaatat---cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||| ||||||||||||    ||||||||||||||||||||||||||||||||| | | |||||||||||||||||    
13545387 acatgatgttttgcaaatacacccccctgaagttttgcacttatgtgcaaaatgcctcccgaacttgaaaatttatat 13545310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #137
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 24325084 - 24325005
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| |||| |||| |||| |||||||||||||||| ||||||| ||||||| ||||    
24325084 tgaacatgacgttttgcaaatacccccctgaaattttacactaatgtgcaaaatgccccccaaacttaaaaatttgtatt 24325005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #138
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 26359273 - 26359352
Alignment:
99 aacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| || |||||||||||||| |||||||||||||| |||  |||||| ||||||||||||||    
26359273 aacataacgttttgcaaataccctcctgaagttttgcatttatgtgcaaaatgtcccctaaacttaaaaatttatatttt 26359352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #139
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 746501 - 746555
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
746501 tgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatattttt 746555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #140
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 2745449 - 2745391
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||||||||||| |||||  ||||||||||||||||||||||    
2745449 cccctgaaattttgcacttatgtgcaaaacgccccttaaacttgaaaatttatattttt 2745391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #141
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 5574098 - 5574175
Alignment:
99 aacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||||||   |||||||||||||  ||||||||||||||||||||   |||||||||||||||||    
5574098 aacatgacgttttgcaaatactccccctgaagttttttacttatgtgcaaaatgccccttgaacttgaaaatttatat 5574175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #142
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 171
Target Start/End: Original strand, 6864466 - 6864539
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    ||||||||||||||||||||||    ||||||||||| |||||||||||||||||||| ||||||| ||||||||    
6864466 tgaacatgacgttttgcaaatactttctgaagttttgtacttatgtgcaaaatgcccc-caaacttaaaaattta 6864539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #143
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 26394847 - 26394789
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||| |||||||||||||||||||||  ||||||||||||||||||||||    
26394847 cccctgaaattttacacttatgtgcaaaatgccccataaacttgaaaatttatattttt 26394789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #144
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 27500872 - 27500818
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||||||||||||||||||  ||||||||||||||||||    
27500872 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatttatat 27500818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #145
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 32293754 - 32293831
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||| ||||||||||||||| |||| | ||||||||||||||||||||||||||||| | ||||| |||||||||||    
32293754 tgaacaagacgttttgcaaatacccccataaagttttgcacttatgtgcaaaatgcccc-cgaacttaaaaatttatat 32293831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #146
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 38090484 - 38090542
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||||||||||||| |||  ||||||||||||||||||||||    
38090484 cccctgaaattttgcacttatgtgcaaaatgtcccataaacttgaaaatttatattttt 38090542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #147
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 40988832 - 40988779
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| |||||||||||||||||||||||||| |||||||||||||||||||||||    
40988832 tgaaattttgcacttatgtgcaaaatgcccc-caaacttgaaaatttatattttt 40988779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #148
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 4000006 - 4000071
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
4000006 caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 4000071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #149
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 146
Target Start/End: Complemental strand, 16362848 - 16362799
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaa 146  Q
    |||||||||||||||||||||| | |||||||||||||||||||||||||    
16362848 tgaacatgacgttttgcaaatacctcctgaagttttgcacttatgtgcaa 16362799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #150
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 36498622 - 36498671
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt 169  Q
    |||||||| |||||||||||||||||||||||||| ||||||||||||||    
36498622 cccctgaaattttgcacttatgtgcaaaatgccccacaaacttgaaaatt 36498671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #151
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 2301376 - 2301297
Alignment:
99 aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    ||||||||||||| ||||||  || | ||||||||| |||||||||||||||||||||   |||||||||||||||||||    
2301376 aacatgacgttttacaaatacatcacatgaagttttacacttatgtgcaaaatgcccctttaacttgaaaatttatattt 2301297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #152
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 98 - 169
Target Start/End: Original strand, 7978570 - 7978642
Alignment:
98 gaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt 169  Q
    ||||||||| ||||||||||||| || ||||||||||||||||||||||||||| ||  ||||||| ||||||    
7978570 gaacatgacattttgcaaatatctccatgaagttttgcacttatgtgcaaaatgtcctccaaacttaaaaatt 7978642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #153
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 14196004 - 14196080
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||| |||| |||  || |||||||||||||||||| ||||||||||| | |||||||||||||||||    
14196004 aacatgacgttttacaaacatcttcttgaagttttgcacttatgtacaaaatgccccccgaacttgaaaatttatat 14196080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #154
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 17648338 - 17648262
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| |||||||||| |||||||||||||||||| |   ||||| |||||||||||    
17648338 aacatgacgttttgcaaatacccccctgaagttttgtacttatgtgcaaaatgcctcctgaacttaaaaatttatat 17648262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #155
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 99 - 151
Target Start/End: Complemental strand, 21086226 - 21086174
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgc 151  Q
    |||| |||||||||||||||||| || ||||||||||||||||||||||||||    
21086226 aacacgacgttttgcaaatatcctcttaagttttgcacttatgtgcaaaatgc 21086174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #156
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 25751863 - 25751919
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattt 176  Q
    |||||||| |||||||||||||||||||||| |||  ||||||||||||||||||||    
25751863 cccctgaaattttgcacttatgtgcaaaatgtcccctaaacttgaaaatttatattt 25751919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #157
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 6914262 - 6914340
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| | ||| ||||||||| ||||||||||||||| | |   |||||||||||||||||||||    
6914262 aacatgacgttttgcaaata-ctcctaaagttttgcgcttatgtgcaaaatgtctcttgaacttgaaaatttatattttt 6914340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #158
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 96 - 174
Target Start/End: Original strand, 9587642 - 9587721
Alignment:
96 atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||| ||||| |||| | |||||||||| |||| |||||||||||||   |||||||||||||||||    
9587642 atgaacatgacgttttgtaaatacccccctaaagttttgcatttatatgcaaaatgccccctgaacttgaaaatttatat 9587721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #159
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 17587983 - 17587901
Alignment:
97 tgaacatgacgtttt-gcaaatatcccct--gaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||| ||||||| |||||  |||||||||||||||||||||||||| |||| ||||||| | ||||||||||    
17587983 tgaacatgacgtttttgcaaataccccctctgaagttttgcacttatgtgcaaaatgcccccccaaacttaataatttatatt 17587901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #160
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 19293203 - 19293128
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| | | | ||||||||||||||||||||||||  |||   |||||||||||||||||    
19293203 aacatgacgttttgcaaatacctcattaagttttgcacttatgtgcaaaatatcccctgaacttgaaaatttatat 19293128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #161
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 21640045 - 21640124
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||| ||||||||||||||| ||||  ||||||||||||||||||||||||||  || | ||||| ||||||||||||    
21640045 tgaacaagacgttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgttccccgaacttaaaaatttatatt 21640124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #162
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 26242912 - 26242990
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| ||||||||||| || || ||||||||||||||| ||||| |||||||||| | ||||| |||||||||||||||    
26242912 aacatcacgttttgcaattaccctctgaagttttgcactaatgtggaaaatgcccc-cgaacttaaaaatttatattttt 26242990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #163
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 36086238 - 36086183
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||| ||||  || ||||||||||||||||||||||||||    
36086238 aacatgacgttttgcaaataccccccaaaattttgcacttatgtgcaaaatgcccc 36086183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #164
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 729488 - 729546
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
729488 cccctgaaattttgcacttatgtgcaaaatgccccttaaacttaaaaatttagattttt 729546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #165
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 10623441 - 10623387
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| |||||||||||| |||||||||||||  ||||||||||||||||||    
10623441 cccctgaaattttgcacttatatgcaaaatgccccctaaacttgaaaatttatat 10623387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #166
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 13968761 - 13968707
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||||||||||| ||||||  ||||||||||||||||||    
13968761 cccctgaaattttgcacttatgtgcaaattgccccctaaacttgaaaatttatat 13968707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #167
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 21362476 - 21362400
Alignment:
99 aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||| ||||  ||||||||||||||  ||||||||||||||||||||   |||||||||||||||||    
21362476 aacatgacgttttgcgaatagctcccctgaagttttt-acttatgtgcaaaatgcccctagaacttgaaaatttatat 21362400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #168
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 25823078 - 25823160
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||||| |||||||||||| | |||||||||||||||||||||| ||||||| ||  ||| || |||||||||||||||    
25823078 tgaatatgacattttgcaaatattcacctgaagttttgcacttatgtgtaaaatgctccttaaatttaaaaatttatattttt 25823160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #169
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 29835513 - 29835571
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
29835513 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 29835571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #170
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 32294629 - 32294569
Alignment:
97 tgaacatgacgttttgcaaatatccc---ctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||||| |||   ||||||||||||| ||||||||||||||||||    
32294629 tgaacatgacgttttgcaaatacccctccctgaagttttgcagttatgtgcaaaatgcccc 32294569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #171
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 36499169 - 36499111
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
36499169 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 36499111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #172
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 38091354 - 38091296
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
38091354 cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt 38091296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #173
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 40988060 - 40988118
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
40988060 cccctgaaattttgcacttatgtgcaaaatgccccataaacttaaaaatttagattttt 40988118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #174
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 107 - 168
Target Start/End: Original strand, 41084741 - 41084802
Alignment:
107 gttttgcaaatatc-ccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaat 168  Q
    |||||||||||| | |||||||||||||||||||||||||||||||||| ||||||| |||||    
41084741 gttttgcaaataccaccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaaaat 41084802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #175
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 4001069 - 4001020
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatt 169  Q
    |||||||| ||||||||||||||||||||||||||  |||||||||||||    
4001069 cccctgaaattttgcacttatgtgcaaaatgccccctaaacttgaaaatt 4001020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #176
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 10622889 - 10622954
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| |||||||||||| |||||||||||||  |||||| |||||||| ||||||    
10622889 caaataccccctgaaattttgcacttatatgcaaaatgccccctaaacttaaaaatttagattttt 10622954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #177
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 129 - 178
Target Start/End: Original strand, 25525104 - 25525153
Alignment:
129 ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||||  |||||||||||||| |||||||    
25525104 ttttgcacttatgtgcaaaatgccccataaacttgaaaatttgtattttt 25525153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #178
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 7950922 - 7950999
Alignment:
99 aacatgacgttttgcaaata---tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||| |||||||   ||||||||||||||||||| ||||||||||| ||||   |||||||||||||||||    
7950922 aacatgacgttt-gcaaataccttcccctgaagttttgcactaatgtgcaaaataccccttgaacttgaaaatttatat 7950999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #179
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 101 - 152
Target Start/End: Original strand, 21360655 - 21360707
Alignment:
101 catgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgcc 152  Q
    |||||| ||||||||||| |||| |||||||||||||||||||||||||||||    
21360655 catgaccttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcc 21360707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #180
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 178
Target Start/End: Complemental strand, 26244071 - 26244000
Alignment:
107 gttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||| ||| ||||||| ||||||||||||||||||| |||| | |||||||||||| ||||||||    
26244071 gttttgcaaatacccctctgaagtcttgcacttatgtgcaaaatacccc-cgaacttgaaaattgatattttt 26244000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #181
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 34216990 - 34217066
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| | | ||||||||||||||| |||||||||||||||    |||||||||||||||||    
34216990 aacatgatgttttgcaaataccgctctgaagttttgcactcatgtgcaaaatgccctctgaacttgaaaatttatat 34217066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #182
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 5382345 - 5382287
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||| ||||||||||||||||||  |||||| |||||||| ||||||    
5382345 cccctgaaattttgcaattatgtgcaaaatgccccctaaacttaaaaatttagattttt 5382287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #183
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 13968068 - 13968126
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||||| |||||||||||  |||||| |||||||| ||||||    
13968068 cccctgaaattttgcacttatgtacaaaatgccccataaacttaaaaatttagattttt 13968126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #184
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 25752891 - 25752833
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||| |||||||||||||||||||||  |||||| |||||||| ||||||    
25752891 cccctgaaattttacacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 25752833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #185
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 27500317 - 27500383
Alignment:
113 caaatatcccctgaag-ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||| ||  ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
27500317 caaatatccccttaaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 27500383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #186
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 29836029 - 29835975
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| |||||||||||||||||||||| |||  ||| ||||||||||||||    
29836029 cccctgaaattttgcacttatgtgcaaaatgtcccataaatttgaaaatttatat 29835975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #187
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 33159801 - 33159743
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| ||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
33159801 ccccagaatttttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 33159743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #188
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 148
Target Start/End: Complemental strand, 36089811 - 36089761
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaa 148  Q
    |||||||||||||||||||| ||||  ||||||||||||||||||||||||    
36089811 aacatgacgttttgcaaatacccccccgaagttttgcacttatgtgcaaaa 36089761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #189
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 99 - 151
Target Start/End: Original strand, 21085879 - 21085932
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgc 151  Q
    |||||||| ||||||||||| || | ||||||||||||||||||||||||||||    
21085879 aacatgacattttgcaaatactctcttgaagttttgcacttatgtgcaaaatgc 21085932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #190
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 99 - 144
Target Start/End: Original strand, 27188064 - 27188109
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgc 144  Q
    ||||||| |||||||||||| ||||| |||||||||||||||||||    
27188064 aacatgaggttttgcaaataccccctaaagttttgcacttatgtgc 27188109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #191
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 730310 - 730254
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaac-ttgaaaatttatattttt 178  Q
    ||||| ||||||||||||||||||||||||||  |||| || |||||||||||||||    
730310 ctgaaattttgcacttatgtgcaaaatgccccctaaactttaaaaatttatattttt 730254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #192
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 25455684 - 25455760
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| ||| |  |||||||| ||||||||||||||||||   | |||||||||||||||||    
25455684 aacatgatgttttgcaaatacccctcaaaagttttgtacttatgtgcaaaatgccattcgaacttgaaaatttatat 25455760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #193
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 26662182 - 26662238
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||  | |||||||||||  |||||||||||||||||||||    
26662182 aacatgacgttttgcaaatgcttccctgaagtttcacacttatgtgcaaaatgcccc 26662238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #194
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 26933777 - 26933833
Alignment:
99 aacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||||||||||||||||  | |||||||||||  |||||||||||||||||||||    
26933777 aacatgacgttttgcaaatgcttccctgaagtttcacacttatgtgcaaaatgcccc 26933833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #195
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 120 - 164
Target Start/End: Original strand, 30971363 - 30971407
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttga 164  Q
    ||||||||||||||||||||||||| ||||||||| | |||||||    
30971363 cccctgaagttttgcacttatgtgcgaaatgccccccgaacttga 30971407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #196
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 126 - 178
Target Start/End: Original strand, 38424264 - 38424316
Alignment:
126 aagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||||  ||| | ||||| |||||||||||||||    
38424264 aagttttgcacttatgtgcaaaatatccctcgaacttaaaaatttatattttt 38424316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #197
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 151
Target Start/End: Original strand, 17587368 - 17587423
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgc 151  Q
    |||||| ||||||||||||||| ||| ||||| ||||||| |||||||||||||||    
17587368 tgaacaagacgttttgcaaatacccctctgaaattttgcatttatgtgcaaaatgc 17587423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #198
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 167
Target Start/End: Complemental strand, 25525919 - 25525872
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa 167  Q
    |||||||| ||||||||||||||||||||||||||   ||||||||||    
25525919 cccctgaaattttgcacttatgtgcaaaatgccccctgaacttgaaaa 25525872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #199
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 123 - 170
Target Start/End: Original strand, 33158973 - 33159019
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    ||||| ||||||||||||||||||||||||||  ||||||||||||||    
33158973 ctgaaattttgcacttatgtgcaaaatgcccc-taaacttgaaaattt 33159019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #200
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 39048412 - 39048353
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatg-ccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||||||||||||| ||||  |||||| |||||||| ||||||    
39048412 cccctgaaattttgcacttatgtgcaaaatgcccccataaacttaaaaatttagattttt 39048353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #201
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 747465 - 747407
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||| ||  | |||| |||||||| ||||||    
747465 cccctgaaattttgcacttatgtgcaaaatgctccctatacttaaaaatttagattttt 747407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #202
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 2744923 - 2744977
Alignment:
124 tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||| |||||||||||||||||||||||||   |||||| |||||||| ||||||    
2744923 tgaaattttgcacttatgtgcaaaatgccctataaacttaaaaatttagattttt 2744977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #203
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 11276707 - 11276761
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||| ||||||||||||||||||||| |||  | || ||||||||||||||    
11276707 cccctgaaattttgcacttatgtgcaaaataccctccgaatttgaaaatttatat 11276761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #204
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 34217275 - 34217194
Alignment:
99 aacatgacgttttgcaaata--tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||| ||||||||||||  || | | ||||||||||||||||||||||||| ||    ||||| |||||||||||||||    
34217275 aacatgatgttttgcaaatacctcacgttaagttttgcacttatgtgcaaaatgtccgttgaacttaaaaatttatattttt 34217194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #205
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 101 - 178
Target Start/End: Complemental strand, 12853058 - 12852981
Alignment:
101 catgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||||||||  || || || || ||||||||||||||| |    ||||||||||||||| |||||    
12853058 catgacgttttgcaaatatccctcgatgtcttccaattatgtgcaaaatgcacattgaacttgaaaatttatgttttt 12852981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #206
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 154
Target Start/End: Complemental strand, 16868212 - 16868171
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgcccc 154  Q
    |||||| |||||||| |||||| |||||||||||||||||||    
16868212 caaataccccctgaaattttgctcttatgtgcaaaatgcccc 16868171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #207
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 129 - 174
Target Start/End: Original strand, 39047466 - 39047511
Alignment:
129 ttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||| |||||||||||||   |||||||||||||||||    
39047466 ttttgcacttatctgcaaaatgccccctcaacttgaaaatttatat 39047511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #208
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 13544693 - 13544768
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| |||| ||||||||||| ||||||||| |||| |||| | ||||| ||| |||||||    
13544693 aacatgatgttttgcaaatacccccttgaagttttgc-cttatgtgcgaaataccccccgaacttaaaagtttatat 13544768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #209
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 21305973 - 21305917
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||| |||||||||||||| ||| | |||| |||||||||||||||||||| ||||    
21305973 aacatcacgttttgcaaatacccctttgaagatttgcacttatgtgcaaaatccccc 21305917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #210
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 21313811 - 21313755
Alignment:
99 aacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgcccc 154  Q
    ||||| |||||||||||||| ||| | |||| |||||||||||||||||||| ||||    
21313811 aacatcacgttttgcaaatacccctttgaagatttgcacttatgtgcaaaatccccc 21313755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #211
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 174
Target Start/End: Complemental strand, 25456712 - 25456639
Alignment:
105 acgttttgcaaatatcccc----tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||| |||    |||||||||| |||||||||||||||||| | | || || |||||||||||    
25456712 acgttttgcaaatataccccccttgaagttttgaacttatgtgcaaaatgccgcccgaatttaaaaatttatat 25456639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0444 (Bit Score: 64; Significance: 1e-27; HSPs: 2)
Name: scaffold0444
Description:

Target: scaffold0444; HSP #1
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8003 - 7924
Alignment:
97 tgaacatgacgttttgcaaatatcc-cctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
8003 tgaacatgacgttttgcaaatatcctcctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 7924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0444; HSP #2
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7111 - 7190
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||| ||||||| ||||||||||||    
7111 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatttgcaaaatgccccccaaacttaaaaatttatatt 7190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 63; Significance: 4e-27; HSPs: 3)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 41888 - 41810
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||| ||||||||||||    
41888 tgaacatgacgttttgcaaataccccctgaagttttgcacttacgtgcaaaatgccccccaaacttaaaaatttatatt 41810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 35967 - 36046
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| ||||  |||||||||||||||||||||||||||||| |||| || ||||||||||||    
35967 tgaacatgatgttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgccccccaaaattaaaaatttatatt 36046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #3
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41280 - 41359
Alignment:
97 tgaacatgacgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| ||||  |||||||||||||||||||||||||||||| |||| || ||||||||||||    
41280 tgaacatgatgttttgcaaatacccccccgaagttttgcacttatgtgcaaaatgccccccaaaattaaaaatttatatt 41359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083 (Bit Score: 62; Significance: 2e-26; HSPs: 2)
Name: scaffold0083
Description:

Target: scaffold0083; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 97 - 177
Target Start/End: Original strand, 3359 - 3440
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||    
3359 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccgaacttgaaaatttatatttt 3440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 105 - 175
Target Start/End: Complemental strand, 4694 - 4623
Alignment:
105 acgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||| |||| |||||||||||||||||||||||||||||||  |||||| | ||||||||||    
4694 acgttttgcaaatacccccgtgaagttttgcacttatgtgcaaaatgccccctaaacttaataatttatatt 4623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 60; Significance: 3e-25; HSPs: 5)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7216 - 7295
Alignment:
97 tgaacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
7216 tgaacatgacgttttgcaaataccccactgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 7295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 7824 - 7745
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
7824 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 7745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #3
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 46646 - 46718
Alignment:
102 atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||||||||||| ||| |||||||||||||||||||||||||| || | | |||||||||||||||||    
46646 atgacgttttgcaaataccccatgaagttttgcacttatgtgcaaaatacctcccgaacttgaaaatttatat 46718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #4
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 96 - 174
Target Start/End: Original strand, 66719 - 66798
Alignment:
96 atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||| |||||||||||| |||| |||||||||||| |||||||||||| ||||| ||||||| |||||||||||    
66719 atgaacatgaagttttgcaaatacccccctgaagttttgcatttatgtgcaaaaagccccccaaacttaaaaatttatat 66798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 67300 - 67224
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| ||||||||| ||||||||||||||||| |||   |||||||||||||||||    
67300 aacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgacccctgaacttgaaaatttatat 67224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 60; Significance: 3e-25; HSPs: 2)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 12426 - 12505
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
12426 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 12505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036; HSP #2
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 13036 - 12956
Alignment:
97 tgaacatgacgttttgcaaatat--cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
13036 tgaacatgacgttttgcaaatactccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 12956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 60; Significance: 3e-25; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 185733 - 185812
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| || ||||||||||||    
185733 tgaacatgacgttttgcaaatactcccctgaagttttgcacttatgtgcaaaatgccccccaaatttaaaaatttatatt 185812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0572 (Bit Score: 59; Significance: 1e-24; HSPs: 1)
Name: scaffold0572
Description:

Target: scaffold0572; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 1687 - 1609
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||| ||||||||||||    
1687 tgaacattacgttttgcaaataccccctgaagttttacacttatgtgcaaaatgccccccaaacttaaaaatttatatt 1609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0498 (Bit Score: 59; Significance: 1e-24; HSPs: 2)
Name: scaffold0498
Description:

Target: scaffold0498; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 5318 - 5395
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||    
5318 tgaacatgacgttt-gcaaatatcccctgaagttttgcgcttatgtgcaaaatgccccccaaacttaaaaatttatatt 5395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0498; HSP #2
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 11311 - 11233
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
11311 tgaacatgacattttgtaaataccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 11233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0095 (Bit Score: 59; Significance: 1e-24; HSPs: 1)
Name: scaffold0095
Description:

Target: scaffold0095; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 52351 - 52428
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
52351 tgaacatgacgttttgcaaata-cccctgaagttttgcacttatgtgcaaaatgtcccccaaacttaaaaatttatatt 52428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 56; Significance: 6e-23; HSPs: 2)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 8156 - 8077
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
8156 tgaacatgacgttttgtaaatacccccctgaagttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 8077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 7548 - 7627
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||| ||| ||||||| ||||||||||||    
7548 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgtccc-caaacttaaaaatttatatt 7627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0945 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: scaffold0945
Description:

Target: scaffold0945; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 2180 - 2102
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||  | |||||||||||||||||    
2180 tgaacatgacgttttgcaaataatctcctgaagttttgcacttatgtgcaaaatgcccatcgaacttgaaaatttatat 2102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0945; HSP #2
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 1301 - 1377
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| | || || ||||||||||||    
1301 aacatgacgttttgcaaatatccccctaaagttttgcacttatgtgcaaaatgcccc-cgaagttaaaaatttatatt 1377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1532 (Bit Score: 54; Significance: 1e-21; HSPs: 1)
Name: scaffold1532
Description:

Target: scaffold1532; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 178
Target Start/End: Complemental strand, 828 - 748
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||||| ||||||||||||||||||||| ||||||||  ||| | |||||||||||||||||||||    
828 tgaacatgacgttttgcaaata-cccctgaagttttgcacttatatgcaaaataacccccgaacttgaaaatttatattttt 748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0445 (Bit Score: 54; Significance: 1e-21; HSPs: 2)
Name: scaffold0445
Description:

Target: scaffold0445; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 102 - 178
Target Start/End: Complemental strand, 13543 - 13467
Alignment:
102 atgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||||||| ||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||    
13543 atgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgcccc-cgaacttgaaaatttatattttt 13467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0445; HSP #2
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 12970 - 13049
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| || ||||||||| |||||    
12970 aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaaattaaaaatttatgttttt 13049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0340 (Bit Score: 54; Significance: 1e-21; HSPs: 2)
Name: scaffold0340
Description:

Target: scaffold0340; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 2349 - 2270
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||| |||||||||||||| ||||  ||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
2349 aacataacgttttgcaaataccccccttgaagttttgcacttatgtgcaaaatgcccc-caaacttgaaaatttatatttt 2270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0340; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 1438 - 1515
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| || |  | |||||||| ||||||||||||||||||||   |||||||||||||||||    
1438 aacatgacgttttgcaaatacccacactaaagttttgtacttatgtgcaaaatgccccctgaacttgaaaatttatat 1515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 54; Significance: 1e-21; HSPs: 3)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 94380 - 94457
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||| ||||| | |||||||||||    
94380 tgaacatgaagttttgcaaataccccctgatgttttgcacttatgtgcaaaatgccccccaaacataaaaatttatat 94457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 94959 - 94883
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| | |||||||||||||||||    
94959 aacatgacgttttgcaaatacccccctgaagttttacacttatgtgcaaaatgccccccgaacttgaaaatttatat 94883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031; HSP #3
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 104460 - 104383
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
104460 tgaacatga-gttttgcaaatacccccctgaaattttgcacttatgtgcaaaatgcccc-caaacttaaaaatttatatt 104383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008 (Bit Score: 53; Significance: 4e-21; HSPs: 1)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 96 - 175
Target Start/End: Original strand, 239296 - 239376
Alignment:
96 atgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||| || |||||||||    
239296 atgaacataacgttttgcaaatatccccctgaagttttgcacttatatgcaaaatgccccccaaacttaaatatttatatt 239376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0343 (Bit Score: 52; Significance: 2e-20; HSPs: 2)
Name: scaffold0343
Description:

Target: scaffold0343; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 10262 - 10340
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| || |||||||||    
10262 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttaaacatttatatt 10340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0343; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 10868 - 10790
Alignment:
97 tgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||||||||||||||||||||| || ||||| |||| ||||| | ||||||||||||    
10868 tgaacatgacgttttgcaaatactcccctgaagttttgcacttatatgtaaaatacccc-caaacataaaaatttatatt 10790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0320 (Bit Score: 52; Significance: 2e-20; HSPs: 2)
Name: scaffold0320
Description:

Target: scaffold0320; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 15669 - 15748
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaa-gttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  || ||||||||||||||||||||||||||| ||||||| ||||||||||||    
15669 tgaacatgacgttttgcaaatacccccctaatgttttgcacttatgtgcaaaatgccccccaaacttaaaaatttatatt 15748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0320; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 16202 - 16156
Alignment:
108 ttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccc 153  Q
    ||||||||||| |||| ||||||||||||||||||||||||||||||    
16202 ttttgcaaatacccccctgaagttttgcacttatgtgcaaaatgccc 16156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0219 (Bit Score: 52; Significance: 2e-20; HSPs: 1)
Name: scaffold0219
Description:

Target: scaffold0219; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 22262 - 22341
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||||||||| ||||| |||||||||||||| ||||||||||||||| ||||   |||||||||||||||||||||    
22262 aacatgacgttttgtaaataccccctgaagttttgtacttatgtgcaaaataccccctgaacttgaaaatttatattttt 22341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0022 (Bit Score: 52; Significance: 2e-20; HSPs: 2)
Name: scaffold0022
Description:

Target: scaffold0022; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 120762 - 120841
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||| |||||||||||| |||| |||||||||||||||||||| |||||||||| ||||||| ||||||||||||    
120762 tgaacatgatgttttgcaaatacccccatgaagttttgcacttatgtgtaaaatgccccccaaacttaaaaatttatatt 120841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0022; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 121370 - 121292
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||| ||||||| |||||| ||||  ||||||||||||||||| ||||||||||||  ||||||| ||||||||||||    
121370 tgaacataacgttttacaaataccccccctgaagttttgcacttatatgcaaaatgccc--caaacttaaaaatttatatt 121292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 52; Significance: 2e-20; HSPs: 4)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 102 - 177
Target Start/End: Complemental strand, 38169 - 38094
Alignment:
102 atgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttt 177  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||| |||| | ||||| |||||||| |||||    
38169 atgacgttttgcaaataccccctgaagttttgcacttatgtgcaaaatacccctcgaacttaaaaatttagatttt 38094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 131039 - 131097
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||| ||||||||  |||||| |||||||||||||||    
131039 cccctgaaattttgcacttatgtgcataatgccccctaaacttaaaaatttatattttt 131097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 131584 - 131529
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||| ||||||||||||||||||||||||||  |||||| |||||||| ||||||    
131584 ctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaatttagattttt 131529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 105 - 149
Target Start/End: Original strand, 37817 - 37862
Alignment:
105 acgttttgcaaatatcccct-gaagttttgcacttatgtgcaaaat 149  Q
    |||||||||| ||| ||||| |||||||||||||||||||||||||    
37817 acgttttgcagatacccccttgaagttttgcacttatgtgcaaaat 37862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 77086 - 77165
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| |||||||  |||||||||||    
77086 tgaacatgacgttttgcaaataccccccctgaagttttgcacttatgtgcaaaatgcccc-caaacttacaaatttatatt 77165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 43366 - 43286
Alignment:
97 tgaacatgacgttttgcaaatatccc--ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| |||  |||||||||| ||||||||||||||||||||| |||| || ||||||||||||    
43366 tgaacatgacgttttgcaaatacccctcctgaagttttacacttatgtgcaaaatgccccccaaagttaaaaatttatatt 43286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 41460 - 41532
Alignment:
97 tgaacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||| ||||      |||||||||||||||||||| |||| ||||||| ||||||||||||    
41460 tgaacatgacgttttgcaaatacccccc-----tttgcacttatgtgcaaaatacccc-caaacttaaaaatttatatt 41532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0132 (Bit Score: 49; Significance: 9e-19; HSPs: 1)
Name: scaffold0132
Description:

Target: scaffold0132; HSP #1
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 42430 - 42354
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| | |||||||| |||||||||||||||||||||  |||||||||||||||||    
42430 aacatgacgttttgcaaatacccccctaaagttttgtacttatgtgcaaaatgccccgtgaacttgaaaatttatat 42354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0287 (Bit Score: 46; Significance: 6e-17; HSPs: 1)
Name: scaffold0287
Description:

Target: scaffold0287; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 97 - 175
Target Start/End: Original strand, 17406 - 17486
Alignment:
97 tgaacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||| ||||||||||||| || ||||  |||||||||||||||||||||||||||||||  |||||| ||||||||||||    
17406 tgaacgtgacgttttgcaagtaccccccctgaagttttgcacttatgtgcaaaatgcccccaaaacttaaaaatttatatt 17486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1063 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold1063
Description:

Target: scaffold1063; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 969 - 894
Alignment:
99 aacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||| |||| |||| || |||||||||||    
969 aacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatacccc-caaaattaaaaatttatat 894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1063; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 99 - 151
Target Start/End: Original strand, 389 - 442
Alignment:
99 aacatgacgttttgcaaatatccc-ctgaagttttgcacttatgtgcaaaatgc 151  Q
    |||||||||||||||||||| ||| |||||||||||||||||||||||||||||    
389 aacatgacgttttgcaaatacccctctgaagttttgcacttatgtgcaaaatgc 442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0608 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 1)
Name: scaffold0608
Description:

Target: scaffold0608; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 97 - 150
Target Start/End: Original strand, 1846 - 1900
Alignment:
97 tgaacatgacgttttgcaaatatcccc-tgaagttttgcacttatgtgcaaaatg 150  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||    
1846 tgaacatgacgttttgcaaatacccccctgaagttttgcacttatgtgcaaaatg 1900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0140 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 2)
Name: scaffold0140
Description:

Target: scaffold0140; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 102 - 175
Target Start/End: Original strand, 4509 - 4583
Alignment:
102 atgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    ||||||||||||||||| ||||||||||||| ||| |||||||||||||| ||| | ||||| ||||||||||||    
4509 atgacgttttgcaaatactcccctgaagtttagcagttatgtgcaaaatgtcccccgaactttaaaatttatatt 4583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0140; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 99 - 167
Target Start/End: Complemental strand, 5195 - 5127
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaa 167  Q
    ||||||||||||| ||||||   | ||||||||||||||||||||||||||||| ||| ||||| ||||    
5195 aacatgacgttttacaaatacttcttgaagttttgcacttatgtgcaaaatgcctcgcgaacttaaaaa 5127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0672 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 2)
Name: scaffold0672
Description:

Target: scaffold0672; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 113 - 171
Target Start/End: Original strand, 5428 - 5486
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattta 171  Q
    |||||| |||||||| ||||||||||||||||||||||||||  |||||| ||||||||    
5428 caaataccccctgaaattttgcacttatgtgcaaaatgccccctaaacttaaaaattta 5486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0672; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 170
Target Start/End: Complemental strand, 6257 - 6207
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaattt 170  Q
    ||||| || ||||||||||||||||||||||||||  |||||| |||||||    
6257 ccccttaaattttgcacttatgtgcaaaatgccccctaaactttaaaattt 6207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0474 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 2)
Name: scaffold0474
Description:

Target: scaffold0474; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 12287 - 12345
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| ||||||||||||||||||||||||||  |||| ||||||||||| |||||    
12287 cccctgaaattttgcacttatgtgcaaaatgccccctaaacctgaaaatttattttttt 12345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0474; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 13106 - 13048
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||||| |||||||||||| |||||||| ||||  |||||| |||||||| ||||||    
13106 cccctgaaattttgcacttatttgcaaaataccccctaaacttaaaaatttagattttt 13048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0044
Description:

Target: scaffold0044; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 59622 - 59543
Alignment:
96 atgaacatgacgttttgcaaata-tcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||||||||||||||||||  |||||||| |||| || |||||||||||||||| |  |||||| ||||||||||||    
59622 atgaacatgacgttttgcaaatacccccctgaaattttacatttatgtgcaaaatgcctccaaaactt-aaaatttatatt 59543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0214 (Bit Score: 36; Significance: 0.00000000005; HSPs: 2)
Name: scaffold0214
Description:

Target: scaffold0214; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 28649 - 28598
Alignment:
123 ctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||| |||| |||||||||||||||||||||  ||||||||||||||||||    
28649 ctgaaattttacacttatgtgcaaaatgccccttaaacttgaaaatttatat 28598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0214; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 16555 - 16500
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatt 175  Q
    |||||||| |||  ||||||| |||||||||||||  |||||||||||||||||||    
16555 cccctgaaatttgacacttatatgcaaaatgccccctaaacttgaaaatttatatt 16500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0066 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0066
Description:

Target: scaffold0066; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 13535 - 13593
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatatttttg 179  Q
    |||||||| ||||||||||||||||||||||||||  ||| || ||||||||||||||||    
13535 cccctgaaattttgcacttatgtgcaaaatgccccataaa-tttaaaatttatatttttg 13593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 36; Significance: 0.00000000005; HSPs: 2)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 42454 - 42395
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttg-aaaatttatattttt 178  Q
    |||||||| |||||||||||||||||||||||| |  ||||||| |||||||||||||||    
42454 cccctgaaattttgcacttatgtgcaaaatgccacctaaacttgaaaaatttatattttt 42395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 41625 - 41689
Alignment:
113 caaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    |||||| |||||||| |||| || ||||||||||||||||||  |||||| |||||||| ||||||    
41625 caaataccccctgaaattttacatttatgtgcaaaatgcccc-taaacttaaaaatttagattttt 41689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0096 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: scaffold0096
Description:

Target: scaffold0096; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 35024 - 34947
Alignment:
99 aacatgacgttttgcaaatatcccc--tgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    ||||||| |||||||||||| || |  |||||||||||||||| |||||||||||| |   |||||||||||||||||    
35024 aacatgatgttttgcaaataccctccttgaagttttgcacttacgtgcaaaatgcctcctgaacttgaaaatttatat 34947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0096; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 151
Target Start/End: Original strand, 10708 - 10739
Alignment:
120 cccctgaagttttgcacttatgtgcaaaatgc 151  Q
    ||||||||||||||||||||||||||||||||    
10708 cccctgaagttttgcacttatgtgcaaaatgc 10739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0249 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0249
Description:

Target: scaffold0249; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 24397 - 24473
Alignment:
99 aacatgacgttttgcaaatat-cccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatat 174  Q
    |||||||||||||| |||||  ||||| || |||||||||||| |||| |||||||  | |||||||||||||||||    
24397 aacatgacgttttgtaaatacacccctaaatttttgcacttatctgcacaatgcccttcgaacttgaaaatttatat 24473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0063 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0063
Description:

Target: scaffold0063; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 34223 - 34145
Alignment:
99 aacatgacgttttgcaaatatcccctgaagttttgcacttatgtgcaaaatgccccgcaaacttgaaaatttatattttt 178  Q
    ||||||||||||  ||| |||||||| ||||||| |||||| |||||||||| |||   |||||||||||||||| ||||    
34223 aacatgacgtttaacaagtatcccctaaagttttacacttaagtgcaaaatg-cccttgaacttgaaaatttatactttt 34145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University