View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_67 (Length: 353)
Name: NF0214_high_67
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_67 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 189 - 344
Target Start/End: Original strand, 39934698 - 39934853
Alignment:
Q |
189 |
gtcaagttgcaccaacatttttgtttatgtgaaacgaacaaagcaaattaacagtatctggaaatacaatttcaatgactatcatgaaagcaagatccct |
288 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
T |
39934698 |
gtcaagttgcaccaacatttttgtttatgtgaaacgaacaaagcaaattaacaggatctggaaatacaatttcaatggctatcatcaaagcaagatccct |
39934797 |
T |
 |
Q |
289 |
atcggtttcaatcacttggagaattaagccctcctttataaacatgtctttcatct |
344 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39934798 |
atcggtttcaatcacttggagaattaagccctcctttataaacatgtctttcatct |
39934853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 28 - 128
Target Start/End: Original strand, 39934570 - 39934668
Alignment:
Q |
28 |
caaccaacacatgtttgttcaaacttttgcaaccgttgttgatactccaactcattaggcgaccnnnnnnnnnntaccttttccatagtttgatttgatc |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
39934570 |
caaccaacacatgtttgttcaaacttttgcaaccgttgttgatactccaactcattaggcgacc--aaaaaaaataccttttccatagtttgatttgatc |
39934667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1628 times since January 2019
Visitors: 2392