View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_72 (Length: 351)
Name: NF0214_high_72
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 187 - 342
Target Start/End: Original strand, 39934698 - 39934853
Alignment:
Q |
187 |
gtcaagttgcaccaacatttttgtttatgtgaaacgaacaaagcaaattaacagtatctggaaatacaatttcaatgactatcatgaaagcaagatccct |
286 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
T |
39934698 |
gtcaagttgcaccaacatttttgtttatgtgaaacgaacaaagcaaattaacaggatctggaaatacaatttcaatggctatcatcaaagcaagatccct |
39934797 |
T |
 |
Q |
287 |
atcggtttcaatcacttggagaattaagccctcctttataaacatgtctttcatct |
342 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39934798 |
atcggtttcaatcacttggagaattaagccctcctttataaacatgtctttcatct |
39934853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 28 - 127
Target Start/End: Original strand, 39934570 - 39934668
Alignment:
Q |
28 |
caaccaacacatgtttgttcaaacttttgcaaccgttgttgatactccaactcattaggcgaccnnnnnnnnntaccttttccatagtttgatttgatca |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
39934570 |
caaccaacacatgtttgttcaaacttttgcaaccgttgttgatactccaactcattaggcgacc-aaaaaaaataccttttccatagtttgatttgatca |
39934668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1413 times since January 2019
Visitors: 2391