View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_80 (Length: 333)
Name: NF0214_high_80
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_80 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 98 - 177
Target Start/End: Complemental strand, 48600506 - 48600427
Alignment:
Q |
98 |
caatgctctcaagatcactcttctccttctccttgtttccgctattgttgtcgcttgctttactctcccaattgaaaagg |
177 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48600506 |
caatgctctcaagatcactcttctccttctccttgtttccgctattgttgtcgcttgctttactctcccaattgaaaagg |
48600427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 231 - 266
Target Start/End: Complemental strand, 48600373 - 48600338
Alignment:
Q |
231 |
attatcgttcatgatgttctaatggggtgacttcat |
266 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
48600373 |
attatcgttcatgatgttctaatggggtgacttcat |
48600338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2027 times since January 2019
Visitors: 2396