View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_86 (Length: 318)
Name: NF0214_high_86
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_86 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 101 - 239
Target Start/End: Complemental strand, 34704779 - 34704640
Alignment:
| Q |
101 |
ttagttgatgcaatatagtagctgaataattgcgacatgaaacgttctcctattcct-aggctcaactttcatgcatttgagcttcatcgctttgacagg |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34704779 |
ttagttgatgcaacatagtagctgaataattgcgacatgaaacgttctcctattcctgaggctcaactttcatgcatttgagcttcaccgctttgacagg |
34704680 |
T |
 |
| Q |
200 |
ctttgtggcagattcctcaccatccagctcatataccgtc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34704679 |
ctttgtggcagattcctcaccatccagctcatataccgtc |
34704640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 124; Significance: 9e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 101 - 239
Target Start/End: Original strand, 28548422 - 28548561
Alignment:
| Q |
101 |
ttagttgatgcaatatagtagctgaataattgcgacatgaaacgttctcctattcct-aggctcaactttcatgcatttgagcttcatcgctttgacagg |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28548422 |
ttagttgatgcaacatagtagctgaataattgcgacatgaaacgttctcctattcctgaggctcaactttcatgcatttgagcttcaccgctttgacagg |
28548521 |
T |
 |
| Q |
200 |
ctttgtggcagattcctcaccatccagctcatataccgtc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28548522 |
ctttgtggcagattcctcaccatccagctcatataccgtc |
28548561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 101 - 239
Target Start/End: Complemental strand, 41867988 - 41867849
Alignment:
| Q |
101 |
ttagttgatgcaatatagtagctgaataattgcgacatgaaacgttctcctattcct-aggctcaactttcatgcatttgagcttcatcgctttgacagg |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41867988 |
ttagttgatgcaacatagtagctgaataattgcgacatgaaacgttctcctattcctgaggctcaactttcatgcatttgagcttcaccgctttgacagg |
41867889 |
T |
 |
| Q |
200 |
ctttgtggcagattcctcaccatccagctcatataccgtc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41867888 |
ctttgtggcagattcctcaccatccagctcatataccgtc |
41867849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University