View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_87 (Length: 317)
Name: NF0214_high_87
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_87 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 3308364 - 3308059
Alignment:
Q |
1 |
ctttgcctcctcctcctcgtcctgatttgcctgctgctctccggcgtgctattaccatgccggagtttgaatcagacatggttgtggaagaggaagagga |
100 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3308364 |
ctttgcctcctcctcctcttcctgatttgcctgctgctctccggcgtgctattaccatgccggagtttgaatcagacatggttgtggaagaggaagagga |
3308265 |
T |
 |
Q |
101 |
tggtgatggtgatgaagaagttgttggaagagtgaaagagagagtgaatatggatatgattcaagtgttgagtgaagttgataatcattttataatggct |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3308264 |
tggtgatggtgatgaagaagttgttggaagagtgaaagagagagtgaatatggatatgattcaagtgttgagtgaagttgataatcattttataatggct |
3308165 |
T |
 |
Q |
201 |
tctgaagctgctcgcggtgtttctgtgattcttcaggctactcgtcttcactttcattcaaatttttctgatactgctagaggtaaccacaaaaatccat |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3308164 |
tctgaagctgctcgcggtgtttctgtgattcttcaggctactcgtcttcactttcattcaaatttttctgatactgctagaggtaaccacaaaaatccat |
3308065 |
T |
 |
Q |
301 |
gttcat |
306 |
Q |
|
|
|||||| |
|
|
T |
3308064 |
gttcat |
3308059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2346 times since January 2019
Visitors: 2400