View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_93 (Length: 302)
Name: NF0214_high_93
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_93 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 31 - 212
Target Start/End: Original strand, 47574639 - 47574826
Alignment:
Q |
31 |
ctcctcctcctgacttttttgctggaggttcaggtgctggagcaggt------ggaggtggagcttgagcgacaaaaacttgaggttggggtggaggagg |
124 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
47574639 |
ctcctcctcctgacttttttgctggaggttcatgtgcaggagcaggtggaggtggaggtggagtttgagcgacaaaaacttgaggttggggtggaggagg |
47574738 |
T |
 |
Q |
125 |
atacccttgataacatggttgacccccttgataacccggttgaggatatcctacatagttcaagtagttatcgttcaaatttagtcat |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47574739 |
atacccttgataacatggttgacccccttgataacccggttgaggatatcctacatagttcaagtagttatcgttcaaatttagtcat |
47574826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 188
Target Start/End: Original strand, 47569715 - 47569818
Alignment:
Q |
79 |
gaggtggagcttgagcgacaaaaacttgaggttggggtggaggaggatacccttgataacatggttgacccccttgataacccggttgaggatatcctac |
178 |
Q |
|
|
||||||||||||||| ||| ||||||||||||||||||| |||||||||||| | | | || |||||||||||| ||||||||||||||||| |
|
|
T |
47569715 |
gaggtggagcttgagtgacgaaaacttgaggttggggtgctggaggataccctgg------ttgaggatacccttgataacctggttgaggatatcctac |
47569808 |
T |
 |
Q |
179 |
atagttcaag |
188 |
Q |
|
|
|||||||||| |
|
|
T |
47569809 |
atagttcaag |
47569818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University