View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_96 (Length: 297)
Name: NF0214_high_96
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_96 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 26 - 288
Target Start/End: Complemental strand, 42677281 - 42677019
Alignment:
Q |
26 |
gattttctggtggaaattctcaatctcttgatggttccaaattgtccaaaataagcttccgccatctccatctctttgaagccatgtggaatcaacccaa |
125 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||| |
|
|
T |
42677281 |
gattttctggtggaaattctcaatctcttgatggttccaaattgtccaaaataagctttcgccatctccatctcttagaagccatgtggaatcaaaccaa |
42677182 |
T |
 |
Q |
126 |
tatacaaaacatgggaagtattctccaatggtttgcggctaggaccagcttccaacgacaaaaaatcagcaccatgctcaaatggaaaaaattaaatggc |
225 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
T |
42677181 |
tatacaaaacatgggaagtattctccaatggtttgcgactaggaccagcttccaacgacaaaaaatcagcaccatgctcaaatggatagaattaaatggc |
42677082 |
T |
 |
Q |
226 |
aatggctttataccacacgaaagagatctgattacactaaaacatattcgctttgattttctt |
288 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42677081 |
aatggctttataccacacgaaagagatctgattacactaaaacatattcgctttgattttctt |
42677019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 52835009 - 52834967
Alignment:
Q |
40 |
aattctcaatctcttgatggttccaaattgtccaaaataagct |
82 |
Q |
|
|
||||||||||||||||| ||| || |||||||||||||||||| |
|
|
T |
52835009 |
aattctcaatctcttgacggtaccgaattgtccaaaataagct |
52834967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 7e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 36 - 82
Target Start/End: Original strand, 48969535 - 48969581
Alignment:
Q |
36 |
tggaaattctcaatctcttgatggttccaaattgtccaaaataagct |
82 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48969535 |
tggaaattctcaatctcttgatggttccaaattgtccaaaataagct |
48969581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 87 - 159
Target Start/End: Original strand, 48969712 - 48969784
Alignment:
Q |
87 |
ccatctccatctctttgaagccatgtggaatcaacccaatatacaaaacatgggaagtattctccaatggttt |
159 |
Q |
|
|
|||||||| |||| | |||||||||||||||| ||||||||||||||| |||||| |||||||||| |||| |
|
|
T |
48969712 |
ccatctccttctcatagaagccatgtggaatccgaccaatatacaaaacaggggaagaattctccaattgttt |
48969784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2373 times since January 2019
Visitors: 2400