View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_97 (Length: 296)
Name: NF0214_high_97
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_97 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 52 - 222
Target Start/End: Original strand, 3338761 - 3338932
Alignment:
| Q |
52 |
caaaggggaagaattaaggttttcaaaaagtggtaggagtatgatttcactatttataaagctctaataagcacgtttggaaatcccaatccaatggcca |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338761 |
caaaggggaagaattaaggttttcaaaaagtggtaggagtatgatttcactatttataaagctctaataagcacgtttggaaatcccaatccaatggcca |
3338860 |
T |
 |
| Q |
152 |
agctacaacgaataaataaagatgtctcataaccctt-aaatcagactgaagcaacaaaaagactaactatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3338861 |
agctacaacgaataaataaagatgtctcaaaacccttaaaatcagactgaagcaacaaaaagactaactatg |
3338932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University