View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_101 (Length: 313)
Name: NF0214_low_101
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_101 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 92 - 241
Target Start/End: Complemental strand, 38085786 - 38085636
Alignment:
| Q |
92 |
agatttaaatgaaaataaaatagcaattagtacaatagacaagtatgagcctagatgcatcatttttt-gttagtgtagtgttgtgcataagatgcttca |
190 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38085786 |
agatgtaaatgaaaataaaatagcaattagtacaatagacaagtatgagcctagatgcatcatttttttgttagtgtagtgttgtgcataagatgcttca |
38085687 |
T |
|
| Q |
191 |
aatttataagtgtcactctatgctctaatttttattggtatatagaataat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38085686 |
aatttataagtgtcactctatgctctaatttttattggtatatagaataat |
38085636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 100 - 198
Target Start/End: Complemental strand, 38081362 - 38081266
Alignment:
| Q |
100 |
atgaaaataaaatagcaattagtacaatagacaagtatgagcctagatgcatcattttttgttagtgtagtgttgtgcataagatgcttcaaatttata |
198 |
Q |
| |
|
||||||||||||||||||| ||| ||| |||||| ||||||| |||| |||||||||| | ||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
38081362 |
atgaaaataaaatagcaataagtgcaacagacaaatatgagcttagaggcatcattttgtttta--gtaatgttgtgcatatgatgcttcaaatttata |
38081266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1948 times since January 2019
Visitors: 2394