View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_103 (Length: 307)
Name: NF0214_low_103
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_103 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
[»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 101 - 307
Target Start/End: Complemental strand, 34704779 - 34704573
Alignment:
Q |
101 |
ttagttgatgcaatatagtagctgaataattgcgacatgaaacgttctcctattcctaaggctcaactttcatgcatttgagcttcatcgctttgacagg |
200 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
34704779 |
ttagttgatgcaacatagtagctgaataattgcgacatgaaacgttctcctattcctgaggctcaactttcatgcatttgagcttcaccgctttgacagg |
34704680 |
T |
 |
Q |
201 |
ctttgtggcagattcctcaccatccagctcatataccgtcagatctgaaatagcattctcagcagatcttttgcccaccgctttgctgcagggtctctgc |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
T |
34704679 |
ctttgtggcagattcctcaccatccagctcatataccgtcagatctgaaatagcattctcagcagatcttttgcccaccgctttgctgtagggtgtctgc |
34704580 |
T |
 |
Q |
301 |
tcctcct |
307 |
Q |
|
|
|| |||| |
|
|
T |
34704579 |
tcatcct |
34704573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 101 - 307
Target Start/End: Original strand, 28548422 - 28548628
Alignment:
Q |
101 |
ttagttgatgcaatatagtagctgaataattgcgacatgaaacgttctcctattcctaaggctcaactttcatgcatttgagcttcatcgctttgacagg |
200 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
28548422 |
ttagttgatgcaacatagtagctgaataattgcgacatgaaacgttctcctattcctgaggctcaactttcatgcatttgagcttcaccgctttgacagg |
28548521 |
T |
 |
Q |
201 |
ctttgtggcagattcctcaccatccagctcatataccgtcagatctgaaatagcattctcagcagatcttttgcccaccgctttgctgcagggtctctgc |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
T |
28548522 |
ctttgtggcagattcctcaccatccagctcatataccgtcagatctgaaatagcattctcagcagatcttttgcccaccgctttgctgtagggtgtctgc |
28548621 |
T |
 |
Q |
301 |
tcctcct |
307 |
Q |
|
|
|| |||| |
|
|
T |
28548622 |
tcatcct |
28548628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 101 - 307
Target Start/End: Complemental strand, 41867988 - 41867782
Alignment:
Q |
101 |
ttagttgatgcaatatagtagctgaataattgcgacatgaaacgttctcctattcctaaggctcaactttcatgcatttgagcttcatcgctttgacagg |
200 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
41867988 |
ttagttgatgcaacatagtagctgaataattgcgacatgaaacgttctcctattcctgaggctcaactttcatgcatttgagcttcaccgctttgacagg |
41867889 |
T |
 |
Q |
201 |
ctttgtggcagattcctcaccatccagctcatataccgtcagatctgaaatagcattctcagcagatcttttgcccaccgctttgctgcagggtctctgc |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
T |
41867888 |
ctttgtggcagattcctcaccatccagctcatataccgtcagatctgaaatagcattctcagcagatcttttgcccaccgctttgctgtagggtgtctgc |
41867789 |
T |
 |
Q |
301 |
tcctcct |
307 |
Q |
|
|
|| |||| |
|
|
T |
41867788 |
tcatcct |
41867782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1038 times since January 2019
Visitors: 2388