View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_106 (Length: 302)
Name: NF0214_low_106
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_106 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 21 - 274
Target Start/End: Original strand, 44450199 - 44450452
Alignment:
| Q |
21 |
agcagagatccaatgtaagttctttattctttgacattcacaatttattttgctatataagctattcaaatgccattgttctattactcaatttctttaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44450199 |
agcagagatccaatgtaagttctttattctttgacattcacaatttattttgctatataagctattcaaatgccattgttctattactcaatttctttaa |
44450298 |
T |
|
| Q |
121 |
gcctattgaaaaattcctgtcatcaatgatttcacgtgcattgtttttgtcctacttcggacggaaatgatgtgttttaggctttagcaaacatgttgat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44450299 |
gcctattgaaaaattcctgtcatcaatgatttcacgtgcattatttttgtcctacttcggacggaaatgatgtgttttaggctttagcaaacatgttgat |
44450398 |
T |
|
| Q |
221 |
gtcatactgtttgtgctttgtagtgtagagagtacacactcaggtgccggaagt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44450399 |
gtcatactgtttgtgctttgtagtgtagagagtacacactcaggtgccggaagt |
44450452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1130 times since January 2019
Visitors: 2389