View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_low_107 (Length: 302)

Name: NF0214_low_107
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_low_107
NF0214_low_107
[»] chr3 (2 HSPs)
chr3 (31-212)||(47574639-47574826)
chr3 (79-188)||(47569715-47569818)


Alignment Details
Target: chr3 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 31 - 212
Target Start/End: Original strand, 47574639 - 47574826
Alignment:
31 ctcctcctcctgacttttttgctggaggttcaggtgctggagcaggt------ggaggtggagcttgagcgacaaaaacttgaggttggggtggaggagg 124  Q
    |||||||||||||||||||||||||||||||| |||| |||||||||      |||||||||| ||||||||||||||||||||||||||||||||||||    
47574639 ctcctcctcctgacttttttgctggaggttcatgtgcaggagcaggtggaggtggaggtggagtttgagcgacaaaaacttgaggttggggtggaggagg 47574738  T
125 atacccttgataacatggttgacccccttgataacccggttgaggatatcctacatagttcaagtagttatcgttcaaatttagtcat 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47574739 atacccttgataacatggttgacccccttgataacccggttgaggatatcctacatagttcaagtagttatcgttcaaatttagtcat 47574826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 188
Target Start/End: Original strand, 47569715 - 47569818
Alignment:
79 gaggtggagcttgagcgacaaaaacttgaggttggggtggaggaggatacccttgataacatggttgacccccttgataacccggttgaggatatcctac 178  Q
    ||||||||||||||| ||| |||||||||||||||||||  |||||||||||| |      | |  ||  |||||||||||| |||||||||||||||||    
47569715 gaggtggagcttgagtgacgaaaacttgaggttggggtgctggaggataccctgg------ttgaggatacccttgataacctggttgaggatatcctac 47569808  T
179 atagttcaag 188  Q
    ||||||||||    
47569809 atagttcaag 47569818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1821 times since January 2019
Visitors: 2393