View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_109 (Length: 301)
Name: NF0214_low_109
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_109 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 59 - 221
Target Start/End: Original strand, 29273624 - 29273786
Alignment:
| Q |
59 |
gttctgtgtggcgctgatgatgtatataatggttgtgtgcattcaattttccttcacaatcaaatttgtttcaggatatttgtttgccagtgagactttg |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29273624 |
gttctgtgtggcgctgatgatgtatataatggttgtgtgcattcagttttccttcacaatcaaatttgtttcaggatatttgtttggcagtgagactttg |
29273723 |
T |
 |
| Q |
159 |
tattgcactcatggaaaattatggattgggtgagtttaactcaacttctccatcttcttccta |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29273724 |
tattgcactcatggaaaattatggattgggtgagtttaactcaacttctccatcttcttccta |
29273786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 59 - 221
Target Start/End: Complemental strand, 55860942 - 55860779
Alignment:
| Q |
59 |
gttctgtgtggcgctgatgatgtatataatggttgtgtgcattcaattttccttcacaatcaaatttgtttcaggatatttgtttgccagtgagactttg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| || |||||||| ||||||||||||| |
|
|
| T |
55860942 |
gttctgtgtggcgctgatgatgtatataatggttgtttgcattcagttttccttcacaatcaaatttgtttcagaatttttgtttggcagtgagactttg |
55860843 |
T |
 |
| Q |
159 |
tattgcactcatggaaaattatggattgggtgagtttaac-tcaacttctccatcttcttccta |
221 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55860842 |
tattgcactcatggaaaattaaggatagggtgagtttaacgtcaacttctccatcttcttccta |
55860779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University