View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_110 (Length: 299)
Name: NF0214_low_110
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_110 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 79 - 207
Target Start/End: Original strand, 35848312 - 35848440
Alignment:
Q |
79 |
gcagagatcaggaacgagccaatgattcaggaccaccgagagattgtgatgtcacatctccatcttgaatcttaagatattggggatacgagttatcttt |
178 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
T |
35848312 |
gcagagatcaggaacgagccaatgattcaggaccaccgagagattgtgacgtcacatctccatcctgaatcttaagatattgggtatacgagttatcttt |
35848411 |
T |
 |
Q |
179 |
cacatatatccaacatttagtgtatttgt |
207 |
Q |
|
|
|||||| |||||| ||||||| ||||||| |
|
|
T |
35848412 |
cacatacatccaatatttagtttatttgt |
35848440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1695 times since January 2019
Visitors: 2393