View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_low_112 (Length: 296)

Name: NF0214_low_112
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_low_112
NF0214_low_112
[»] chr1 (1 HSPs)
chr1 (52-222)||(3338761-3338932)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 52 - 222
Target Start/End: Original strand, 3338761 - 3338932
Alignment:
52 caaaggggaagaattaaggttttcaaaaagtggtaggagtatgatttcactatttataaagctctaataagcacgtttggaaatcccaatccaatggcca 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3338761 caaaggggaagaattaaggttttcaaaaagtggtaggagtatgatttcactatttataaagctctaataagcacgtttggaaatcccaatccaatggcca 3338860  T
152 agctacaacgaataaataaagatgtctcataaccctt-aaatcagactgaagcaacaaaaagactaactatg 222  Q
    ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||    
3338861 agctacaacgaataaataaagatgtctcaaaacccttaaaatcagactgaagcaacaaaaagactaactatg 3338932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University