View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_low_113 (Length: 295)

Name: NF0214_low_113
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_low_113
NF0214_low_113
[»] chr2 (1 HSPs)
chr2 (91-295)||(41680124-41680328)


Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 91 - 295
Target Start/End: Complemental strand, 41680328 - 41680124
Alignment:
91 gtgtgtctccttattatttccgttggaacgaggtttttcttctattagggacacaatttgctggtggtgtttttcttggaacatcaatgatgcatttctt 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41680328 gtgtgtctccttattatttccgttggaacgaggtttttcttctattagggacacaatttgctggtggtgtttttcttggaacatcaatgatgcatttctt 41680229  T
191 gagtgattcaaatgaaacttttgaagatcttaccaagaaaacttacccttttgccttcatgttggcttgttctggctatcttttaaccatgtttgttgat 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||    
41680228 gagtgattcaaatgaaacttttgaagatcttaccaagaaaacttacccttttgccttcatgttggcttgttctggatatcttttaaccatgtttggtgat 41680129  T
291 tgtgt 295  Q
    |||||    
41680128 tgtgt 41680124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1368 times since January 2019
Visitors: 2391