View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_113 (Length: 295)
Name: NF0214_low_113
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_113 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 91 - 295
Target Start/End: Complemental strand, 41680328 - 41680124
Alignment:
| Q |
91 |
gtgtgtctccttattatttccgttggaacgaggtttttcttctattagggacacaatttgctggtggtgtttttcttggaacatcaatgatgcatttctt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41680328 |
gtgtgtctccttattatttccgttggaacgaggtttttcttctattagggacacaatttgctggtggtgtttttcttggaacatcaatgatgcatttctt |
41680229 |
T |
 |
| Q |
191 |
gagtgattcaaatgaaacttttgaagatcttaccaagaaaacttacccttttgccttcatgttggcttgttctggctatcttttaaccatgtttgttgat |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
41680228 |
gagtgattcaaatgaaacttttgaagatcttaccaagaaaacttacccttttgccttcatgttggcttgttctggatatcttttaaccatgtttggtgat |
41680129 |
T |
 |
| Q |
291 |
tgtgt |
295 |
Q |
| |
|
||||| |
|
|
| T |
41680128 |
tgtgt |
41680124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University