View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_low_117 (Length: 292)

Name: NF0214_low_117
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_low_117
NF0214_low_117
[»] chr7 (1 HSPs)
chr7 (79-292)||(21955854-21956067)


Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 79 - 292
Target Start/End: Complemental strand, 21956067 - 21955854
Alignment:
79 gtttgggtgttatgggagaagggaggtttgtggtggtgttgggcatggtggaagatttgaagggagagataagggtcgtgttggcgggaaatgagagatg 178  Q
    ||||||| |||||| ||||| ||||||||||| |||| |||||| ||| |||||||||||||||||| || |||||||||||||||||||||||||||||    
21956067 gtttgggggttatgagagaatggaggtttgtgatggttttgggcgtggaggaagatttgaagggagaaatgagggtcgtgttggcgggaaatgagagatg 21955968  T
179 agaggagtttggggttgaggcggtggggccaggggttgattgggggttggactttgaaggaatctgggagggaaggtgtggtggttgtattggcagcgat 278  Q
    |||||||||||||||||||||||||||||||||| |||||||| ||||||| |||| | || | |||||||||||||||||||||||| |||||  ||||    
21955967 agaggagtttggggttgaggcggtggggccagggtttgattggaggttggattttgtatgattgtgggagggaaggtgtggtggttgtgttggcgacgat 21955868  T
279 ggcggccgagattg 292  Q
     ||||| |||||||    
21955867 tgcggcggagattg 21955854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University