View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_119 (Length: 284)
Name: NF0214_low_119
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_119 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 37 - 163
Target Start/End: Original strand, 2163075 - 2163201
Alignment:
| Q |
37 |
cattattcgcattttttatgtggtttttctttcgataaaccggccgaagagatcgggaaaaattcccttttaatttggaaaatccttttgacgaaaatct |
136 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2163075 |
cattattcacattttttatgtggtttttctttcgataaaccggccgaagagatcggaaaaaattcccttttaatttggaaaatccttttgacgaaaatct |
2163174 |
T |
|
| Q |
137 |
agaaaatcttagcttggaatctctgca |
163 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
2163175 |
agaaaatattagcttggaatctctgca |
2163201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1291 times since January 2019
Visitors: 2391