View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_127 (Length: 269)
Name: NF0214_low_127
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_127 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 154 - 254
Target Start/End: Complemental strand, 26297904 - 26297804
Alignment:
Q |
154 |
gattaaatacataaatcaagtagaataaatgttgaagattttctacttataaaacttaaatgttgaagatttcttgctaaacaagtgatgatgatgtcca |
253 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
T |
26297904 |
gattaaatacataaatcaagtagaataaatgttgaagattttctacttataaaacttaaatgttgaagatttcttgttaaacaagtgatgatgatttcca |
26297805 |
T |
 |
Q |
254 |
t |
254 |
Q |
|
|
| |
|
|
T |
26297804 |
t |
26297804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 77 - 161
Target Start/End: Complemental strand, 26298536 - 26298452
Alignment:
Q |
77 |
gtaatctcaagacaaagttgcactcattttttatattatttataactacctatgaaactttggttttgagtttatgtgattaaat |
161 |
Q |
|
|
|||| ||||||||||| |||||| ||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
T |
26298536 |
gtaagctcaagacaaacttgcacccattttttagattatttataactacctatgtaactttggatttgagtttatgtgattaaat |
26298452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University