View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_13 (Length: 545)
Name: NF0214_low_13
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 437; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 437; E-Value: 0
Query Start/End: Original strand, 91 - 531
Target Start/End: Complemental strand, 41680328 - 41679888
Alignment:
| Q |
91 |
gtgtgtctccttattatttccgttggaacgaggtttttcttctattagggacacaatttgctggtggtgtttttcttggaacatcaatgatgcatttctt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41680328 |
gtgtgtctccttattatttccgttggaacgaggtttttcttctattagggacacaatttgctggtggtgtttttcttggaacatcaatgatgcatttctt |
41680229 |
T |
 |
| Q |
191 |
gagtgattcaaatgaaacttttgaagatcttaccaagaaaacttacccttttgccttcatgttggcttgttctggatatcttttaaccatgtttggtgat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41680228 |
gagtgattcaaatgaaacttttgaagatcttaccaagaaaacttacccttttgccttcatgttggcttgttctggatatcttttaaccatgtttggtgat |
41680129 |
T |
 |
| Q |
291 |
tgtgtggtggtttatgtaacaagtaataatcagagggaagctaaagttgaggaacttgaaggaggaagaacacctcaagaagaagagggaacgaccgagt |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41680128 |
tgtgtggtggtttatgtaacaagtaataatcagagggaagctaaagttgaggaacttgaaggaggaagaacacctcaagaagaagagggaacgaccgagt |
41680029 |
T |
 |
| Q |
391 |
tggcgatggatgagagcaacgttgcatttatgaagactactaatgtgggagatactattttgcttattcttgcactttgttttcattcggtttttgaagg |
490 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41680028 |
tggcgatggatgagagcaacgttgcattcatgaagactactaatgtgggagatactattttgcttattcttgcactttgttttcattcggtttttgaagg |
41679929 |
T |
 |
| Q |
491 |
catagccgttggaatttcaggttatttcgcaatccatcgtt |
531 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41679928 |
catagccgttggaatttcaggttatttcgcaatccatcgtt |
41679888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University