View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_137 (Length: 266)
Name: NF0214_low_137
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_137 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 32 - 222
Target Start/End: Original strand, 40471912 - 40472098
Alignment:
Q |
32 |
atgtagcggataagttattttggaaatttctgttagaatttggttttggagctaattaactcaacctccgaagttagctcacggaatgaggggttgtccc |
131 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40471912 |
atgtagcggataatttattttggaaatttctgttagaatttggttttggag----ttaactcaacctccgaagttagctcacggaatgaggggttgtccc |
40472007 |
T |
 |
Q |
132 |
cacacttataatcatcgtttgtatcattgcactaaccaatatgctcacatcctaaacacggcatctggagcgtaaagtttacatgcctaaa |
222 |
Q |
|
|
| |||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
T |
40472008 |
ctcacttataatcatcgtttatatcattgcactaaccaatgtgctcacatccaaaacacgacatctggagcgtaaagtttacatgcctaaa |
40472098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1350 times since January 2019
Visitors: 2391