View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_140 (Length: 265)
Name: NF0214_low_140
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_140 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 44 - 238
Target Start/End: Original strand, 173141 - 173336
Alignment:
| Q |
44 |
atatcatggaggctggcacttaccatgataggccaagaactttccctaacatgcgttctaaaccttacaccccgctggtattatcttaccattatatttc |
143 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
173141 |
atatcatggagactggcacttaccatgataggccaagaactttccctaacatgcgttctaaaccttacaccccgctggtattatcttaccattatattt- |
173239 |
T |
 |
| Q |
144 |
cccccattttccaatg--tatctatatatatactctattatcttcttacataattgttttctgcagatatttcgtattctactcggtataaatgttc |
238 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
173240 |
cccccattttccaatgtatatatatatatatactctattatcttcttacataattgttttcttcagatatttcgtattctactcggtataaatgttc |
173336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University