View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_145 (Length: 261)
Name: NF0214_low_145
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_145 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 39 - 241
Target Start/End: Complemental strand, 45280674 - 45280472
Alignment:
| Q |
39 |
aattatatccttccatgtacagtgtcactttctagtttccatttattgtttaatttttgttggagtttatatttgaaagacttcaccatgcagcgtacgt |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45280674 |
aattatatccttccatgtacagtgtcactttctagtttccatttattgtttaatttttgttggagtttatatttgaaagtcttcaccatgcagcgtacgt |
45280575 |
T |
 |
| Q |
139 |
cctgatttgttatgcagcgtacgttctgagatatctcctttaccatccaagatagtgacactctaagcctctaaagtgtttttaacaccatttttatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45280574 |
cctgatttgttatgcagcgtacgttctgagatatctcctttaccatccaagatagtgacactctaagcctctaaagtgtttttaacaccatttttatatt |
45280475 |
T |
 |
| Q |
239 |
cat |
241 |
Q |
| |
|
||| |
|
|
| T |
45280474 |
cat |
45280472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University