View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_151 (Length: 260)
Name: NF0214_low_151
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_151 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 29 - 260
Target Start/End: Complemental strand, 38720227 - 38719995
Alignment:
| Q |
29 |
agaccaagctcctaatttgaccttggtatctagccttacaccaacctgtttgcaaaaatcagaaaataagttcctcttttagagattggtcaatattatg |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
38720227 |
agaccaagctcctaatttgaccttggtatctagccttacaccaacctgtttgcaaaaatcagaaaattagttcctctttcagagattggtcaatattatg |
38720128 |
T |
|
| Q |
129 |
caaaataactgtacacaatgtagaaacttgacaggccaatattggattttagtaaattttgataatattgagc-aagtgttttgagaaaaactcaagccc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38720127 |
caaaataactgtacacaatgtagaaacttgacaggctaatattggattttagtaaattttgataatattgagcaaagtgttttgagaaaaactcaagccc |
38720028 |
T |
|
| Q |
228 |
catgttaaaaagagataacgtttgaaaattgtt |
260 |
Q |
| |
|
||| ||||||||| |||| |||||||||||||| |
|
|
| T |
38720027 |
catattaaaaagatataatgtttgaaaattgtt |
38719995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 979 times since January 2019
Visitors: 2388