View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_152 (Length: 260)
Name: NF0214_low_152
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_152 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 30 - 251
Target Start/End: Original strand, 26736412 - 26736634
Alignment:
| Q |
30 |
gtatcaagatcggacagtccaaattttaagttcagtattttaatttttaaaaataatcaaaactgcattaaaatttgaactgaccgatattggtccaatt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| | |
|
|
| T |
26736412 |
gtatcaagatcggacagtccaaattttaagttcagtattttaatttttaaaaataatcaaaactgcattagaatttggactgaccgatattggtccaact |
26736511 |
T |
 |
| Q |
130 |
gcaaccgatgtagctgacttaatagcttccaactgatgctgc-aaaatgataggtcctttcttgaggattctaccttcttcatcagaaaatatttctgtt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26736512 |
gcaaccgatgtagctgacttaatagcttccaactgatgctgcaaaaatgataggtcctttcttgaggattctaccttcttcatcagaaaatatttctatt |
26736611 |
T |
 |
| Q |
229 |
aaaacattaatggtgacctatgc |
251 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26736612 |
aaaacattaatggtgacctatgc |
26736634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 32 - 82
Target Start/End: Complemental strand, 51188186 - 51188136
Alignment:
| Q |
32 |
atcaagatcggacagtccaaattttaagttcagtattttaatttttaaaaa |
82 |
Q |
| |
|
||||||||| || |||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
51188186 |
atcaagatctgatagtccaaactttaagttcagtatttttatttttaaaaa |
51188136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University