View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_154 (Length: 259)
Name: NF0214_low_154
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_154 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 77 - 149
Target Start/End: Complemental strand, 16884786 - 16884714
Alignment:
| Q |
77 |
tattctctgatacttcaagatgtgtaagatatgtgcaacttgtcagtgaagtgaggaaattgaattcaagaga |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16884786 |
tattctctgatacttcaagatgtgtaagatatgtgcaacttgtcagtgaagtgaggaaattgaattcaagaga |
16884714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 80 - 149
Target Start/End: Original strand, 5081478 - 5081547
Alignment:
| Q |
80 |
tctctgatacttcaagatgtgtaagatatgtgcaacttgtcagtgaagtgaggaaattgaattcaagaga |
149 |
Q |
| |
|
|||| ||||||||||||||| | | |||| ||||||| ||||||||||| ||||| |||||||||||||| |
|
|
| T |
5081478 |
tctcggatacttcaagatgtttcaaatatctgcaactagtcagtgaagttaggaagttgaattcaagaga |
5081547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 77 - 149
Target Start/End: Complemental strand, 5118073 - 5118001
Alignment:
| Q |
77 |
tattctctgatacttcaagatgtgtaagatatgtgcaacttgtcagtgaagtgaggaaattgaattcaagaga |
149 |
Q |
| |
|
||||| ||||||||||||||| | | |||||| |||||||||| |||||||| ||||| ||||||| |||||| |
|
|
| T |
5118073 |
tattccctgatacttcaagatatttcagatatctgcaacttgtaagtgaagtaaggaagttgaattgaagaga |
5118001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 77 - 149
Target Start/End: Original strand, 14413777 - 14413849
Alignment:
| Q |
77 |
tattctctgatacttcaagatgtgtaagatatgtgcaacttgtcagtgaagtgaggaaattgaattcaagaga |
149 |
Q |
| |
|
||||||||||||| ||||||||||| |||| | | |||||||| |||||||||||||| || | ||||||||| |
|
|
| T |
14413777 |
tattctctgatacatcaagatgtgtcagatgtttacaacttgtaagtgaagtgaggaagtttatttcaagaga |
14413849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University