View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_155 (Length: 259)
Name: NF0214_low_155
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_155 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 20 - 216
Target Start/End: Complemental strand, 27751873 - 27751677
Alignment:
| Q |
20 |
caaagggccatgaaggattcacaaaataaacaataccaagaagaacaagccttgatgaatccaccaaaaaagggaagaaacaaatgtgtaacttgcgtat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27751873 |
caaagggccatgaaggattcacaaaataaacaataccaagaagaacaagccttgatgaatccaccaaaaaagggaagaaacaaatgtgtaacttgcatat |
27751774 |
T |
 |
| Q |
120 |
gcatagtgttgctactattactaattttagtaatagtttgtgttattcttgccttcacccttttcaagccaaaagacccaaaaacaaaggttgtttc |
216 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27751773 |
gcatagtgttattactattactagttttagtaatagtttgtgttattcttgccttcacccttttcaagccaaaagacccaaaaacaaaggttgtttc |
27751677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University