View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_156 (Length: 258)
Name: NF0214_low_156
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_156 |
 |  |
|
| [»] scaffold0194 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0194 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 89 - 229
Target Start/End: Original strand, 5104 - 5245
Alignment:
| Q |
89 |
aaagtccctaaagaacaatctccaaattattcatatatcaaaaatgatttttaagagaatctataacaaacaa-acccaaaaagtttctatgtaaaatgg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
5104 |
aaagtccctaaagaacaatctccaaattattcatatatcaaaaatgatttttaagagaatctataacaaacaacacctaaaaagtttctatgtaaaatgg |
5203 |
T |
 |
| Q |
188 |
ttttgccaactattttcttaataatgacttctatgtaagtac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5204 |
ttttgccaactattttcttaataatgacttctatgtaagtac |
5245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 5016 - 5071
Alignment:
| Q |
1 |
catttttaatcaaattaatgaaaaattgttttgatatgtataattttaaacttgaa |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5016 |
catttttaatcaaattaatgaaaaattgttttgatatgtataattttaaacttgaa |
5071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 160
Target Start/End: Complemental strand, 3490500 - 3490462
Alignment:
| Q |
122 |
tatatcaaaaatgatttttaagagaatctataacaaaca |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
3490500 |
tatatcaaaaattatttttaagagaatctaaaacaaaca |
3490462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University