View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_157 (Length: 258)
Name: NF0214_low_157
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_157 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 29 - 258
Target Start/End: Original strand, 36969788 - 36970017
Alignment:
Q |
29 |
aaacagagggaacagttctcgacacagattttaaatctctgcaatgactttaaagtttaaacagtgggacacaacaacacagggccagatgaaggttgga |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
36969788 |
aaacagagggaacagttctcgacacagattttaaatctctgcaatgactttaaagtttaaacagtgggacacaacaacacagggccagatgaagtttgga |
36969887 |
T |
 |
Q |
129 |
gaacagccatgagttgttctcttacaatttagaaaaaatggggtcaatttgttttcaagcagatacataattagcgttaaacaaaacatgctttaattaa |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36969888 |
gaacagccatgagttgttctcttacaatttagaaaaaatggggtcaatttgttttcaagcagatacataattagcgttaaacaaaacatgctttaattaa |
36969987 |
T |
 |
Q |
229 |
gtagagaactagttacaacatcacagaaca |
258 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
36969988 |
gtagagaactagttacaacatcacagaaca |
36970017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University