View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_158 (Length: 258)
Name: NF0214_low_158
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_158 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 13 - 229
Target Start/End: Original strand, 5376830 - 5377046
Alignment:
| Q |
13 |
tcatcatcactaaaaaccatctcaatagagtttggttgatcagccttcaaaaaagttgggactgcccaaacccgaaccttaaacatccatgcctctatac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5376830 |
tcatcatcactaaaaaccatctcaatagagtttggttgatcagccttcaaaaaagttgggactgcccaaacccgaaccttaaacatccatgcctctatac |
5376929 |
T |
 |
| Q |
113 |
caggaacaacagcagcaacgaatcaaaagatttttccatttcaaattgcaatttcaattttaaaacatggaaccaaagtaatgtgtgaaatgtaattgca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5376930 |
caggaacaacagcagcaacgaatcaaaagatttttccatttcaaattgcaatttcaattttaaaacatggaaacaaagtaatgtgtgaaatgtaattgca |
5377029 |
T |
 |
| Q |
213 |
aattgctcagtaagtac |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5377030 |
aattgctcagtaagtac |
5377046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University