View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_low_160 (Length: 258)

Name: NF0214_low_160
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_low_160
NF0214_low_160
[»] chr3 (1 HSPs)
chr3 (31-218)||(43565897-43566084)


Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 31 - 218
Target Start/End: Complemental strand, 43566084 - 43565897
Alignment:
31 ttttcgatgcaaaacttttattgtcattaagaaacttgccatcatctctatttaaatttacttcatctgataaaaaatataagagatgattgcatccaca 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43566084 ttttcgatgcaaaacttttattgtcattaagaaacttgccatcatctctatttaaatttacttcatctgataaaaaatataagagatgattgcatccaca 43565985  T
131 aaaaatttggctaaataaatcaacttgtattaaatcaacggtatcttatatttaagatttgagtgagtactgagtatcatgaacaacc 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43565984 aaaaatttggctaaataaatcaacttgtattaaatcaacggtatcttatatttaagatttgagtgagtactgagtatcatgaacaacc 43565897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University