View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_160 (Length: 258)
Name: NF0214_low_160
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_160 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 31 - 218
Target Start/End: Complemental strand, 43566084 - 43565897
Alignment:
| Q |
31 |
ttttcgatgcaaaacttttattgtcattaagaaacttgccatcatctctatttaaatttacttcatctgataaaaaatataagagatgattgcatccaca |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43566084 |
ttttcgatgcaaaacttttattgtcattaagaaacttgccatcatctctatttaaatttacttcatctgataaaaaatataagagatgattgcatccaca |
43565985 |
T |
 |
| Q |
131 |
aaaaatttggctaaataaatcaacttgtattaaatcaacggtatcttatatttaagatttgagtgagtactgagtatcatgaacaacc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43565984 |
aaaaatttggctaaataaatcaacttgtattaaatcaacggtatcttatatttaagatttgagtgagtactgagtatcatgaacaacc |
43565897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University