View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_163 (Length: 257)
Name: NF0214_low_163
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_163 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 222
Target Start/End: Complemental strand, 29145179 - 29144970
Alignment:
| Q |
13 |
gagaaaagaaaactaacctggcttgaggaactcgatttcgatgcagggttggcttcattttgaccaacaacttgatcctttttatcatcaaccttagtta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29145179 |
gagaaaagaaaactaacctggcttgaggagcccgatttcgatgcagggttggcttcattttgaccaacaacttgatcctttttatcatcaaccttagtta |
29145080 |
T |
|
| Q |
113 |
ataccaagctagaatcataatctgaagagccatctaaaaaagttgtgtcgctgagcaaagatctagttgaaccatgtggagtaattgagtcagaatttgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29145079 |
ataccaagctagaatcataatctgaagagccatctaaaaaagttgtgtcgctgagcaaagatctagttgaaccatgtggagtaattgagtcagaatttgg |
29144980 |
T |
|
| Q |
213 |
cttaaccaat |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
29144979 |
cttaaccaat |
29144970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1277 times since January 2019
Visitors: 2391