View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_167 (Length: 256)
Name: NF0214_low_167
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_167 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 36 - 235
Target Start/End: Complemental strand, 7310181 - 7309982
Alignment:
Q |
36 |
atgcatctgaaaatgaattagaagagtttcggaaacttgagaatggggaaaactctattatcaaattccatctttcccaagttaattacctcctttgtac |
135 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||||| | |
|
|
T |
7310181 |
atgcatctgaaaatgaattagaagaacttcggaaacttgagaaaggggaaaactttattatcaaattccatctttcccaagttaattacttcctttgttc |
7310082 |
T |
 |
Q |
136 |
agatctgattgttccaagtactacattttgtaacttgtgggcaggctataatcttgagaataatgaaacacttcacatgatttactgtgtttctgtccta |
235 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7310081 |
agatctgattgttccaagcactacattttgtaacttgttggcaggctataatcttgagaataatgaaacacttcacatgatttactgtgtttctgtccta |
7309982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 7329932 - 7329973
Alignment:
Q |
180 |
gctataatcttgagaataatgaaacacttcacatgatttact |
221 |
Q |
|
|
||||||| ||||||||| |||||||||||||||| ||||||| |
|
|
T |
7329932 |
gctataaacttgagaatgatgaaacacttcacatcatttact |
7329973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University