View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_168 (Length: 255)
Name: NF0214_low_168
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_168 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 32 - 255
Target Start/End: Original strand, 24879358 - 24879581
Alignment:
| Q |
32 |
caattaccttccacaacagtaacaaattttagtgagttcaattctatgcaaacccttcaaaaagatagaattgatcattgtagtaatattcatgatgatg |
131 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24879358 |
caattaccatccacaacagtaacaaattttagtgagttcaattctatgcaaacccttcaaaaagatagaattgatcattgtagtaatattcatgatgatg |
24879457 |
T |
 |
| Q |
132 |
ctttgaatgtgaattttgagctaccacctttaccaggtgaagaggattcaccatcacatgatcatgtattgtggtccaattctgaaatgatgataaacct |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24879458 |
gtttgaatgtgaattttgagctaccacctttaccaggtgaagaggattcaccatcacatgatcatgtattgtggtccaattctgaaatgatgataaacct |
24879557 |
T |
 |
| Q |
232 |
tccatttcaagttactcaacctcc |
255 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24879558 |
tccatttcaagttactcaacctcc |
24879581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University