View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_171 (Length: 253)
Name: NF0214_low_171
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_171 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 25575356 - 25575157
Alignment:
Q |
1 |
tagctaaaagagaaccactagagtaatcttctttgtcatcctttctgtcatagccacaggaaggtttgtagcgatcaaattccaaagtattcccattccc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
25575356 |
tagctaaaagagaaccactagagtaatcttctttgtcatcctttctgtcatagccacaggaaggtctgtagcgatcaaattccaaagtattcccattccc |
25575257 |
T |
 |
Q |
101 |
gcagtcagttgccttgccatgagttggctcggcccctctaccaatgcgaccctggttaggaacaacatggccaccttcatctggaaagtctcttcgacga |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25575256 |
gcagtcagttgccttgccatgagttggctcggcccctctaccaatgcgaccctggttaggaacaacatggccaccttcatctggaaagtctcttcgacga |
25575157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University